Quantitative reverse transcriptase PCR (qRT - PCR) was conducted using the SYBR Green qPCR Kit (Fermentas) by using following primers: Actin F: TGAGACCTTCAACACCCCAGCCATG, Actin R: CGTAGATGGGCACAGTGTGGGTG, KLF4 F: GTCTTGAGGAAGTGCTGAGC, KLF4 R: ATCGTCTTCCCCTCTTTGGC. (cancerres.aacrjournals.org)
For each condition, 200 ng genomic DNA was then PCR amplified using Platinum Taq High Fidelity (Invitrogen) using the following primers plus 454 adaptor sequences and 8 letter DNA barcodes: CAACCTCTACAGCAGTGTCCTCATC (forward) and GGAGTGTGACAGCTTGGAGATG (reverse). (journals.plos.org)
The following primer gives a good overview of No Kill. (goodfordogs.org)