«This reaction is interesting as close relatives of this protein, known as
homologs have also been found in animals — ranging from invertebrates like the horseshoe crab to humans — where they play a role in the defence against bacteria,» continues Künzler.
Page and his colleagues, who use animal models to understand how autism risk factors impact the developing brain and to identify potential treatments for the condition, have found that animals with mutations in the autism risk gene phosphatase and tensin
homolog (Pten) mimic aspects of autism, including increased brain size, social deficits and increased repetitive behavior.
The researchers conclude that Upd2 is the «functional
homolog» of leptin, meaning the protein in flies acts very much like leptin does in people.
We determined the x-ray structure of the human BK Ca2 + gating apparatus at a resolution of 3.0 angstroms and deduced its tetrameric assembly by solving a 6 angstrom resolution structure of a Na + - activated
homolog.
No. 5,817,479, entitled Human Kinase
Homologs, claims 44 ESTs which are fragments of genes encoding protein kinases.
«The other major part of the story is that in mycorrhizal lineages there is a huge turnover in genes that are upregulated in the symbiosis - many of these have
no homologs in even closely related species, suggesting that the evolution of the symbiosis is associated with massive genetic innovation.»
Analysis of the primary sequence relationships of DMC1 from Saccharomyces cerevisiae and UvsX of T4 relative to the three - dimensional structure of RecA from Escherichia coli suggests that both proteins are structural
homologs of bacterial RecA proteins.
Using microelectrodes, the researchers recorded the electrical activity of pheromone - sensitive interneurons in male American cockroaches that relay signals of female - producing sex pheromones in the antennal lobe (functional
homolog to the mammalian olfactory bulb) to higher - order centers.
In a report that appears in PLOS BIOLOGY, Dr. Hugo Bellen and his colleagues at Baylor College of Medicine and the Jan and Dan Duncan Neurological Research Institute at Texas Children's Hospital and BCM, and Dr. Chao Tong, at the Life Sciences Institute and Innovation Center for Cell Biology, Zhejiang University in Hangzhou, China, find that mutations of human
homologs (genes that carry out similar functions) of cacophony and its partner straightjacket (Cacna1a and Cacna2d2 respectively) cause defects in autophagy in neurons.
Beclin 1 is the human
homolog of BEC - 1, has been shown to be monoallelically deleted in up to 75 % of various human cancers.
By searching for gene deletion patterns in cancer through a concept the investigators call «synthetic essentiality,» the team identified a synthetic essential gene known as chromatin helicase DNA - binding factor (CHD1) as a therapeutic target for prostate and breast cancers lacking a tumor suppressor gene called phosphatase and tensin
homolog (PTEN).
Genes in the first group were expressed in many organs; these housekeeping genes have X
homologs that escape X inactivation.
The proteins were selected because the same (
homolog) proteins exist in the human brain as well.
It also has
a homolog in humans, known as arginine vasopressin.
A mutation in one of the genes that controls this pathway, PTEN (also known as phosphatase and tensin
homolog), can cause a particular form of autism called macrocephaly / autism syndrome.
Pten (short for phosphatase and tensin
homolog) is a tumor suppressor that is defective in about 20 - 25 percent of all patients with cancers.
In a paper published by Scientific Reports today, the research team found the activity of this protein, called PTEN (for Phosphatase and tensin
homolog deleted on chromosome 10), is different between men and women.
PTEN: phosphatase and tensin
homolog.
Using this type of material, Jin et al. [10] examined the DNA arrangement along stretched chromatin fibers from individual maize centromeres and found that tracts of the maize centromere repeat element CentC were interspersed with CRM, the maize
homolog of CRR, and unknown sequences.
However, at least 16 % or more can not be analyzed with these methods because individuals have a mutation in another mismatch repair gene, PMS2 (PMS 1
homolog 2, mismatch repair system component).
The protein known as phosphatase and tensin
homolog (PTEN) is frequently mutated or affected by cancer as tumors develop.
We identified human X-linked genes whose gametologs have been pseudogenized or completely lost from the Y chromosome and inferred which evolutionary forces may be acting to retain genes on the Y. Although gene loss appears to be largely correlated with the suppression of recombination, we observe that X-linked genes with functional Y
homologs evolve under stronger purifying selection and are expressed at higher levels than X-linked genes with nonfunctional Y
homologs.
Additionally, we support and expand upon the hypothesis that X inactivation is primarily driven by gene loss on the Y. Using linear discriminant analysis, we show that X-inactivation status can successfully classify 90 % of X-linked genes into those with functional or nonfunctional Y
homologs.
In the present study, we identified the kakusei
homolog in the Japanese honeybee and found that the neural activity of one subtype of intrinsic neurons of the mushroom bodies (MBs) is preferentially increased in the brains of the Japanese honeybee workers during the formation of a hot defensive bee ball.
Because no kakusei
homolog had been identified in any other animal species, including insects, however, we first amplified parts of kakusei cDNA from the Japanese honeybee using primers designed from the European honeybee kakusei cDNA sequences.
To obtain cDNA fragments of the kakusei
homolog in Japanese honeybee, PCR was performed using a set of primers designed based on the nucleotide sequence of the European honeybee kakusei, 5 ′ - GGGGAAGCCAGGAGCCGCGGGTTTACAT - 3 ′ and 5 ′ - AGGCAACAGCACACCATGGGCCTTGGAT - 3 ′, with Ex Taq (Takara, Tokyo, Japan).
The use of coded PCR primers enables high - throughput sequencing of multiple
homolog amplification products by 454 parallel sequencing Binladen, J., M. T. P. Gilbert, J. P. Bollback, F. Panitz et al. 2007.
First, we identified an A. cerana
homolog (Acks = Apis cerana kakusei) of kakusei, an immediate early gene that we previously identified from A. mellifera, and showed that Acks has characteristics similar to kakusei and can be used to visualize active brain regions in A. cerana.
In many cases It is more capable of identifying RNA
homologs that conserve their secondary structure more than their primary sequence.
To map the active regions in the brains of the Japanese honeybee workers during the formation of a defensive bee ball, we intended to use the kakusei
homolog as a neural activity marker.
The use of coded PCR primers enables high - throughput sequencing of multiple
homolog amplification products by 454 parallel sequencing.
Functional annotations from Ensembl BioMart, TAIR10, Phytozome, and MaizeGDB were based on
homologs determined through Ensembl Compara gene trees (gramene.org).
IDA - 1, a Caenorhabditis elegans
homolog of the diabetic autoantigens IA - 2 and phogrin, is expressed in peptidergic neurons in the worm.
The C. elegans
homolog of nucleoporin Nup98 is required for the integrity and function of germline P granules.
MicroRNA - 15a inhibition protects against hypoxia / reoxygenation - induced apoptosis of cardiomyocytes by targeting mothers against decapentaplegic
homolog 7.
In the paper, the researchers conducted blood tests on a few dozen people and found that the presence of pre-existing adaptive immune responses in humans to either Cas9
homolog «may hinder the safe and efficacious use of the Cas9 / gRNA system to treat disease, and may even result in significant toxicity to patients.»
Little is known about RNF212, though it is a mammalian
homolog of a gene called ZHP - 3 known to be crucial for the success of recombination in other organisms.
He investigates the chaperones and heat shock proteins (Hsp) found in yeast and mammalian cells (as well as their Escherichia coli
homologs) using structural, biochemical, and cell biological methods.
More research will be needed to understand the significance of the relationship of FcRY and FcRn to their respective
homologs: phospholipase receptors and MHC molecules.
The Rice brassinosteroid - deficient dwarf2 mutant, defective in the rice
homolog of Arabidopsis DIMINUTO / DWARF1, is rescued by the endogenously accumulated alternative bioactive brassinosteroid, dolichosterone
Hermansky - Pudlak syndrome is caused by mutations in HPS4, the human
homolog of the mouse light - ear gene.
The Functions of Myosin II and Myosin V
Homologs in Tip Growth and Septation in Aspergillus nidulans.
In addition,
a homolog of PHYB ACTIVATION - TAGGED SUPPRESSOR1 (BAS1), which encodes an enzyme that inactivates BRs (Neff et al., 1999), was also significantly reduced in the mutant, suggesting that inactivation was also decreased in response to a lack of BRs.
A Ribosome Assembly Factor Ebp2p, the Yeast
Homolog of EBNA1 - Binding Protein 2, Is Involved in the Secretory Response.
B7h, a novel costimulatory
homolog of B7.
On the other hand; neuroblastoma RAS Viral Oncogene
Homolog (NRAS) mutation is known to activate BRAF which results in an anarchic melanocyte growth [30, 31].
Homologs of well - characterized BR biosynthesis genes were significantly upregulated in bsl1 - 1 mutants compared with wild - type controls (Figure 6; Supplemental Table 2).
Phosphatase and tensin
homolog (PTEN): Adding an extra copy of the tumor suppressor gene PTEN to mice produces lower rates of cancer, much as expected, but also increased life span.
Sugar - free frosting,
a homolog of SAD kinase, drives neural - specific glycan expression in the Drosophila embryo.
Extensively expressed in animals, they were found in several bacteria, especially
the homolog from the cyanobacteria Gloeobacter violaceus (GLIC) which functions as a proton-gated ion channel.