Sentences with phrase «dna strand»

DNA Keyring, Hand Stamped Keyring, Science Keyring, DNA keychain, Initial Keyring, Science Gifts, Personalised Keyring, Biology, Dna Strand, Gift

Personalized DNA strand keychain, DNA keyring, biology student, science graduate, name keychain, double helix, gift for her, for him, custom

Throughout the mission, you gain levels (up to ten) which allow you to choose one of two upgrades every time in what Gearbox is calling the Helix system (it's shaped like a DNA strand).

They will be marked with an orange symbol or a light blue DNA strand when Mercer gets near them.

Ian has an unusual hobby of collecting high resolution photos of people's irises; much like a finger print or DNA strand, each is unique to the individual.

The structure of DNA is dynamic along its length, being capable of coiling into tight If we were to hypothetically untwist the DNA strand and lay it flat, it would look like a ladder.

Slamenova, D., Kuboskova, K., Horvathova, E., and Robichova, S. Rosemary - stimulated reduction of DNA strand breaks and FPG - sensitive sites in mammalian cells treated with H2O2 or visible light - excited Methylene Blue.

At the tips of each chromosome, at the end of each DNA strand, there's a cap, like the tip of a shoelace, which keeps our DNA from unraveling and fraying.

Telomeres are the genetic caps on the end of each DNA strand.

So, the question now becomes whether HT turmeric with cooked piperine demonstrates (1) greater activity and (2) reduces DNA strand breakage more than uncooked turmeric / curcumin and uncooked piperine.

This protein synthesis relies on all sorts of enzymes to work, from helicases that open up the DNA strand to be read, to RNA polymerases that create RNA - based on the original DNA sequence, to protein kinases.

They are located at the end of each DNA strand and protect our chromosomes.

Importantly, the new process relies on strategically positioning the gene encoding the capsid variants on the DNA strand between two short sequences of DNA, known as lox sites.

Single DNA strand bearing three copies of the human Maf - recognition element (MARE) core motifs, 5 ′ - CTAGCTGCTGAGTCATGCTGAGTCATGCTGAGTCATC 3 ′, and its complementary strand, 5 ′ - TCGAGATGACTCAGCATGACTCAGCATGACTCAGCAG 3 ′, were synthesized and annealed through standard procedures.

Their technique has shed light on how cells repair DNA strand breaks, which could help scientists learn how to protect astronauts from cosmic rays as well as refine radiotherapy protocols designed to kill tumors.

The parasite chromosomes exhibit limited conservation of gene synteny with Plasmodium falciparum, and its plastid - like genome represents the first example where all apicoplast genes are encoded on one DNA strand.

For example, when the machinery reaches a C in the genetic sequence, it recruits a G into the growing DNA strand, and when it detects a T, it matches it with an A.

Seeman worked out the rules that govern DNA strand design and assembly so as to be able to create specific new shapes and structures.

For example, non-homologous end - joining is involved in the development of lymphocytes in resolving recombination intermediates i.e., DNA strand breaks (DSBs) that occur during V (D) J recombination.

(Left) A single DNA strand (formed by a sugar - phosphate backbone and nucleotide base - pairs).

An enzyme called DNA polymerase, along with several other enzymes that work alongside it, walks down the DNA strand and replicates it.

There are RNA polymerase enzymes attaching to the DNA strand at the starting points of different genes and copying the DNA for the gene into an mRNA molecule.

RNA polymerase transcribes the DNA strand, and ribosomes create the enzymes that the viral DNA specifies.

Then, they showed that when the cancer cells didn't make enough ATRX, the cells couldn't join together the two ends of a broken DNA strand.

Some polyamides are hairpin - shaped (right) and are able to bind to the DNA strand like in the image.

MutL puts a nick in the newly synthesized DNA strand to mark it as defective and signals a different protein to gobble up the portion of the DNA containing the error.

The inhibition of DNMT, especially DNMT1, would block the hypermethylation of the newly synthesized DNA strand, resulting in the reversal of the hypermethylation and the re-expression of the silenced genes (11, 12, 13).

Most sequencing technologies tick off the sequence of DNA's four chemical letters — A's, G's, C's, and T's — by linking fluorescent molecules to the letters and the progression of colors produced by running through the sequence of each DNA strand.

In this system, the DNA strand, with its genes, is coiled around molecules known as histones, which themselves are assembled into larger entities called nucleosomes.

Into each well, researchers insert a copy of a DNA polymerase protein that reads the letters in a DNA strand and uses that information to build a complementary strand, in which A's bind to T's, and C's to G's.

In today's Cell, researchers report that the DNA on the end of human and mouse chromosomes forms a loop, with the exposed end tucked back into the DNA strand.

When a promoter is activated, a molecule called RNA polymerase gets to work, marching down the DNA strand and producing an RNA until it reaches another DNA snippet — a termination sequence — that tells it to stop.

That allows for more interactions between the pore and a DNA strand, which can degrade the electrical signals of interest for sequencing.

The pore seemed to hold promise for sequencing because it has a very narrow and well - defined passage for a DNA strand, Remaut says.

Time - lapse crystallography was used by National Institute of Environmental Health Sciences (NIEHS) researchers to determine that DNA polymerase, the enzyme responsible for assembling the nucleotides or building blocks of DNA, incorporates nucleotides with a specific kind of damage into the DNA strand.

In the randomized, controlled, six - week study the scientists measured the impact of zinc on human metabolism by counting DNA strand breaks.

Some labs have experimented with a version of Cas9 that cuts through a single DNA strand instead of two.

«Our technology can isolate the small molecular building blocks that bind to our DNA strand and organize it into a stringent architecture.

They first altered some of the «residues» on the enzyme's surface that presumably help the guide RNA pair with its matching DNA strand.

The emerging field of epigenetics explores how our lifestyle and environment can change gene expression, for example, by adhering molecules such as methyl groups to the DNA strand.

«When one of these oxidized nucleotides is placed into the DNA strand, it can't pair with the opposing nucleotide as usual, which leaves a gap in the DNA,» Wilson said.

Using a new imaging technique, National Institutes of Health researchers have found that the biological machinery that builds DNA can insert molecules into the DNA strand that are damaged as a result of environmental exposures.

«You have to rely on this really inefficient process that occurs only if you have spontaneous DNA strand breaks that happen to fall within your region of interest,» Niles says.

When Ghadiri poured tPNA molecules into a soup of DNA bits, the tPNA base pairs reshuffled until they matched the sequence of a DNA strand.

Doing so reliably required making millions of copies of the same DNA strand by cloning it in a bacterium, sort of like printing out many versions of a document and then comparing them all to make sure there are no typos.

Specifically, they do this by stopping viral DNA strand transfer with STIs — strand transfer inhibitors.

Opening the sugar destabilizes the otherwise highly stable chemical bond between the oxidized nucleotide base and the DNA strand, and the bond is then broken in further steps.

The job of DNA repair enzymes is therefore to recognize such bases, bind them in their reactive centres, and remove them from the DNA strand.

Made out of a mere five molecules, the Ohio Bobcat Nanowagon checks in at 3.5 nanometers long and 2.5 wide — about the width of a DNA strand.

Histone is a protein that acts like a spool for DNA, helping to package the six - foot long DNA strand into the tiny nucleus of every cell.