Sentences with phrase «luc mbah»

Luc has an incredible story and I know you will LOVE him!
Luc studied Biochemistry at UCLA and holds a Bachelors of Science in Management and MBA in Global Business, both from Pepperdine University.
My guest this week is Luc Berlin, the founder of Miigle +, a platform dedicated to making ethical shopping easier for the consumer and connecting consumers to ethical and sustainable brands.
Seeing it depicted in black - and - white in French film Angel - a by director Luc Besson just showed how magnificent it still looked even when it wasn't in colour.
Exclusive fashion story photographed by Luc Braquet and styled by Tania Rat Patron.
«This study raises the possibility that dietary flavonoid intake is associated with better cognitive evolution,» wrote lead author Luc Letenneur in the American Journal of Epidemiology.
Wall, Benjamin and Luc JC van Loon.
Hi Jean - Luc, I am one of the volunteer moderator on the website.
Thank you for your comment, Luc!
When male SCID / NOD mice were injected with 5 × 106 cells, a baseline signal was not reported until two weeks after inoculation (Mitsiades et al., 2004), while Azab and colleagues, which inoculated 2 × 106 MM.1S - luc cells, reported that it took 3 — 4 weeks for sufficient tumor progression to occur and be detected (Azab et al., 2009).
Jean - Luc Bredas is a Member of the International Academy of Quantum Molecular Science and the European Academy of Sciences and an Associate Member of the Royal Academy of Belgium.
Jean - Luc Margot, as quoted by K. Ramsayer, «Out of Hiding,» Science News, Vol.
Welcome to the world of Exoplanetary Horror, a rundown of the scariest alien worlds likely to frighten even Captain Jean - Luc Picard back into his shuttlecraft.
M. C. Canver, E. C. Smith, F. Sher, L. Pinello, N. E. Sanjana, O. Shalem, D. D. Chen, P. G. Schupp, D. S. Vinjamur, S. Garcia, S. Luc, Y. Fujiwara, T. Maeda, G. C. Yuan, F. Zhang, S. H. Orkin, G. Lettre, D. E. Bauer.
This year, the Day's slogan is «Healthy soil sustains your life: Let's go land degradation neutral», said the Executive Secretary, Luc Gnacadja, when he announced the news to the press on 17 February 2012.
The Grenoble group I visited is one of the world leaders in direct imaging of extrasolar planets: over the past decades Jean - Luc Beuzit and his group have developed more and more sophisticated instruments to enhance the sharpness of the images that can be obtained with the largest telescopes.
2007 - 2011: PhD thesist in the Molecular and Cellular Biology Department, Luc Willems Lab, Gembloux Agro Bio Tech, University of Liege (ULg), Belgium.
February — July 2007: Undergraduate thesist in the Molecular and Cellular Biology Department, Luc Willems Lab, Gembloux Agro Bio Tech, University of Liege (ULg), Belgium.
June - July 2005 - 2006: Research student in the Molecular and Cellular Biology Department, Luc Willems Lab, Faculty of Gembloux, Belgium.
«It opens a new window for SETI,» Luc Arnold, an astronomer with France's Observatoire de Haute - Provence, told Discovery News.
(C) P19 cells were transfected with control vector (tk - luc) or PORE reporter, followed by overnight treatment with indicated combinations of 0.5 mM 8 - Br - cAMP and 200 nM SB202190.
The relative AKT and p53 protein levels in the cells with and without shRNA - LUC, shRNA - GFP, and shRNA - AKT1, were demonstrated by Western blotting.
For DNA transfection, the HepG2, 293, and 293T cells were seeded respectively at 2 × 105, 2 × 105, and 1 × 105 cells / well in 24 - well plates overnight, and then the p53 - TA - Luc luciferase reporter plasmid and RSV - lacZ plasmids were transiently transfected into the cells using NTRII for 6 h, followed by treatment with the test compounds.
There was no significant difference in AKT protein level between the cells without shRNA and those with shRNA - LUC or shRNA - GFP (Fig. 6A and B).
A reporter plasmid, p53 - TA - Luc, was used to quantify p53 activity.
Nucleotide duplexes for luciferase (LUC; CAAATCACAGAATCGTCGTAT, clone ID TRCN0000072246) and green fluorescence protein (GFP; TATCATGGCCGACAAGCA, clone ID: TRCN0000072180) were used as controls for viral infection.
No Rescue for the No Boundary Proposal: Pointers to the Future of Quantum Cosmology, Job Feldbrugge, Jean - Luc Lehners, Neil Turok, arrive: 1708.05104 v1 [hep - th]
ActD (30 nM) highly induced p53 protein in the cells without shRNA and in the cells with shRNA - LUC and shRNA - GFP (Fig. 6A and B).
International Meeting: Land Cover / Land Use Changes (LC / LUC) and Impacts on Environment in South / Southeast Asia
Collaborators on GOBii include Susan McCouch and Mark Sorrells, professors of plant breeding and genetics at Cornell University; Qi Sun, a senior research associate at Cornell's Computational Biology Service Unit; and Ed Buckler and Jean Luc Jannink, geneticists with the USDA Agricultural Research Service.
Evidence of a temperature problem similar in the NLR as in HII regions Luc Binette 2018 April 17, 13:30 IA / U.
On May 3, 2007, team of astronomers (including Jean - Luc Margot; Stan Peale; Igor V. Holin; Raymond F. Jurgens; and Martin A. Slade) announced new evidence that Mercury has a partially molten core using new observations of fluctuations in Mercury's spin obtained with radar signals bounced off the planet from Earth (with the 305 - meter Arecibo, the 34 - meter Goldstone, and the 100 - meter Robert C. Byrd Green Bank radio telescopes).
p53 - TA - Luc contains a p53 response element (p53RE), located upstream of the minimal TA promoter (Clontech, Mountain View, CA).
Lentiviruses were used to individually produce the shRNAs of the green fluorescence protein (GFP), firefly luciferase (LUC), three different shRNAs of human AKT1 (AKT1 - a, - b, and - c), and two different shRNAs of mouse Akt1 (Akt1 - 1 and -2) in the virus - infected cells.
Most low - emission scenarios involve substantial land - use change (LUC) including the expansion of bioenergy and food crops, as well as afforestation.
HepG2 cells in 100 mm cell culture dishes were transfected with pGL - MARE - Luc plasmid DNA along with plasmid carrying the human Bach1 gene or the empty vector pFLAG - CMV - 6c using Fugene6 (Promega).
The clone, pGL - MARE - Luc, was confirmed via DNA sequencing before being used in the luciferase reporter assay.
The distinctions have been handed today, on Friday, November 20th, 2015, by Patrice Soullie, regional delegate of the CNRS and Frédéric Boccard, scientific assistant director of the Institute of the biological sciences of the CNRS (INSB) during a ceremony, in the presence of Catherine Florentz, vice-president of the University of Strasbourg, Big Marie - angel Luc, regional delegate of the Inserm Est, Bertrand Séraphin, director of the IGBMC and Yann Hérault, assistant director of the IGBMC and coordinator of the national infrastructure PHENOMIN.
(B) HepG2 cells were transfected with pGL - MARE - Luc plasmid DNA (containing the HMOX1 E2 promoter) plus a plasmid carrying either pFLAG - Bach1 (WT), pFLAG - Bach1 (AP4 - 7), or pFLAG - only for 24 hours.
The generated DNA fragment was then subjected to NheI and XhoI digestion and cloned into the pGL3 - Luc basic vector that had also been digested with the same restriction enzymes.
However, this DDX3 - induced activation was dramatically decreased in reporter (− 84 +8) p21 - Luc and (− 76 / +8) p21 - Luc by ∼ 2 - to 3-fold and was completely lost in (− 63 / +8) p21 - Luc and (− 56 / +8) p21 - Luc reporters (Fig. 3B).
A, schematic representation of serial p21waf1 / cip1 promoter — driven luciferase reporters used in transactivation assay: p21 - Luc contains the 2.3 - kb full - length of p21waf1 / cip1 promoter (from − 2,326 to +10 nucleotide related transcription start site); its derivatives (− 159 / +8) p21 - Luc, (− 123 / +8) p21 - Luc, (− 84 / +8) p21 - Luc, (− 76 / +8) p21 - Luc, (− 63 / +8) p21 - Luc, and (− 56 / +8) p21 - Luc contain a series of deleted promoters of p21waf1 / cip1.
Land degradation in the drylands, commonly known as desertification, begins with the clearing of vegetation, which means «forests are the first step towards healing the drylands and protecting them from desertification and drought,» as Mr. Luc Gnacadja, Executive Secretary of the United Nations Convention to Combat Desertification (UNCCD) observes.
(− 2,326 / +8) Δ (− 127 / − 63) p21 - Luc is also a derivative of p21 - Luc reporter containing the full - length p21waf1 / cip1 promoter lacking − 127 to − 63 region.
p21waf1 / cip1 promoter — driven luciferase reporter (p21 - Luc; 0.05 - 0.5 μg) and increasing amount (0.1 - 2 μg) of FLAG - DDX3 expression construct were cotransfected into various cell lines as indicated.
To construct the p21waf1 / cip1 internal promoter region (nucleotide − 127 to − 63) deleted reporter plasmid (− 2,325 / +8) Δ (− 127 / − 63) p21 - Luc, the p21 - Luc construct was digested with ApaI, blunted, and then self - ligated.
B and C, HuH - 7 cells were cotransfected with a p21waf1 / cip1 promoter — driven reporter (p21 - Luc) or its derivatives represented in (A)(0.25 μg of each) together with DDX3 expression construct (pcDNA3 - SRα / FLAG - DDX 3) or control vector (pcDNA3 - SRα / FLAG; 2 μg).
a b c d e f g h i j k l m n o p q r s t u v w x y z