Sentences with phrase «reagent kits»

Each gallery contains multiple examples of gene specific in situ RNA detection achieved using one of our RNAscope ® Reagent Kits.

Reagent kits in the 10 x 96 - well format can not be used for TGF - β assays.

He has worked in the biotech industry as a research scientist for over 11 years with a focus on emerging technologies including gene targeting in mice, molecular analysis of transgenes using GFP variants at the single cell level, and developing flow cytometry reagent kits to speed up assay development time for researchers.

RNA was reverse transcribed with a PrimeScript RT reagent Kit (Takara) and quantitative RT - PCR was performed with LightCycler (Roche, Nutley, NJ) using SYBR Premix Ex TaqII (Takara) and gene - specific primers (Acks; 5 ′ - AGTGATGTCTGACCGAGCA - 3 ′ and 5 ′ - CGAACGCACTTTGGTTAGTC - 3 ′ ef - 1α; 5 ′ - TTGGTTTAAGGGATGGACTG - 3 ′ and 5 ′ - CCATACCTGGTTTCAACACA - 3 ′ [49]-RRB-.

RNA was prepared from testis of control and IVC - produced 9 - mo - old mice, using the ULTRASPEC total RNA Isolation Reagent Kit (BioTex Laboratories, Inc.) according to the manufacturer's instructions (two animals pooled per sample, with triplicated samples).

Not exact matches

Swift Biosciences develops enabling products and technologies (reagents and kits) for genomics and personalized medicine.

There are and will continue to be jobs at companies that develop instruments and kits, such as microarrays, reagents, expression kits, and other supplies to fuel research programs.

Promega, headquartered in Madison, Wisconsin, has nearly a thousand employees worldwide and manufactures over two thousand products, consisting of kits and reagents as well as integrated solutions for life science research and drug discovery, genetic identity, and clinical diagnostics.

Seahorse XF test kits and reagents simplify cellular bioenergetics by providing precalibrated, pretested reagents for metabolic phenotyping, mitochondrial respiration, glycolysis, and fatty - acid oxidation in cells.

The cap containing the blood sample is then placed onto the body of the clear plastic test kit, which contains the chemical reagent.

Each kit contains an informative instruction book and enough reagents to repeat up to 50 tests.

Non-exclusive licenses are available for research and sale of products and services across multiple fields including: research tools, kits, reagents; discovery of novel targets for therapeutic intervention; cell lines for discovery and screening of novel drug candidates; GMP production of healthcare products; production of industrial materials such as enzymes, biofuels and chemicals; and synthetic biology.

R&D Systems offers a wide range of reagents and kits designed to study the immune checkpoint, including blocking antibodies, proteins, assays, and more.

AMSBIO offers a range of kits and reagents for the extraction (isolation) of high quality RNA from FFPE tissues and LCM samples that can be used not only for PCR but also microarray applications.

The kit includes lyophilized Xfect Transfection Reagent and gesicle packaging mixes which contain coding sequences for the nanovesicle - inducing glycoprotein, Cas9 endonuclease, and CherryPicker red fluorescent protein.

This kit contains all of the reagents necessary to prepare custom gesicles to deliver Cas9 and a user - defined, gene - specific guide sequence.

As in the first edition of this book, the laboratory course is completely supported by quality - assured products from the Carolina Biological Supply Company, from bulk reagents, to useable reagent systems, to single - use kits, thus satisfying a broad range of teaching applications.

PromoKine offers a wide range of well proven products for cell biology research such as kits and reagents for cell analysis, apoptosis research, cell transfection, fluorescent labeling, gene cloning & expression, mycoplasma detection and elimination as well as numerous antibodies, ELISAs, cytokines and growth factors.

All kit reagents were brought to room temperature before use.

These solutions range from CDx biomarker identification and patient stratification to assay development and reagent manufacturing, to the commercialization of these assays either as services at our harmonized clinical laboratories or as kits available to laboratories in over 65 countries.

Invivoscribe provides ISO 13485 certified, PCR - and NGS - based reagents manufactured in a facility registered with FDA; RUO test kits; CE - marked IVDs, including IdentiClone ® and LymphoTrack ® Dx Assays with both LymphoTrack ® and LymphoTrack ® Dx Software; for clonality, MRD, and somatic hypermutation testing.

The agreement allows us to develop and commercialize internationally - standardized, FDA approved and cleared reagents, kits, and associated bioinformatics software to clinical laboratories and pharmaceutical companies developing new drugs and therapies.

The eBioscience product line contains a comprehensive and innovative portfolio of fluorochrome conjugated antibodies and reagents for immunology, oncology, and multicolor flow cytometry, as well as highly - validated ELISA and multiplex immunoassay kits, recombinant proteins, and general - purpose lab reagents for complete biological system analysis.

Mouse naïve CD4 + T cells were differentiated for 6 days using the reagents included in this kit.

The CellXVivo ™ Mouse Th1 Cell Differentiation Kit contains optimized reagents for Th1 differentiation from naïve CD4 + cells.

CLINIQA, ISO 13485:2003 / 9001:2008 certified, is a clinical diagnostics manufacturer of diagnostic test kits / assays, quality controls, calibrators, linearity calibration verifiers, reagents, proficiency testing materials as well as biological raw materials used worldwide.

Our antibody - based, target - specific protein quantitation reagents, kits, and panels for life science research, collectively called immunoassays, include matched antibody pairs, uncoated and coated - plate ELISA kits, and multiplexing assay tailored to your needs.

Reagents include RUO test kits and CE - marked IVDs, including IdentiClone ® and LymphoTrack ® Dx Assays with LymphoTrack ® Dx Software.

Clinical chemistry assessment was performed using a Beckman - Coulter AU 480 autoanalyzer and reagents from Beckman - Coulter (except free fatty acids, which were measured using kit NEFA - HR2 from Wako Chemicals, and glycerol, which was measured using a kit from Randox Laboratories) as previously described (46, 47).

These products include: an extensive line of research ELISA test kits; substrates and reagents for immunoassay applications; and testing equipment packages.

After being placed in the reagent solution, the blood is transferred to the diagnostic test kit well.

The kit includes 2 bottles of liquid reagent, 2 glass test tubes with snap - tight caps, and step - by - step instructions.