Sentences with phrase «ribosomal protein genes»

Specifically, we have shown that the condensin subunit Cnd2 binds directly to the most important general transcription factor, the TATA box - binding protein TBP, and that TBP recruits condensin molecules onto RNA polymerase III - transcribed genes and highly active Pol II - transcribed genes (many ribosomal protein genes) through the Cnd2 - TBP interaction (Figure A).

These findings may help explain why some people with mutations in certain ribosomal protein genes develop conditions such as Diamond - Blackfan anemia — a blood disorder in which the bone marrow doesn't make enough red blood cells — but don't have problems in other body tissues, Ware says.

More than half of children with DBA have mutations in a ribosomal protein gene, and mutations at least 11 such genes have been linked to DBA.

Not exact matches

Genes encoding ribosomal proteins, DNA replication and repair machinery, oxidative stress, and purine biosynthesis were differentially expressed in Wolbachia during the development of B. malayi female worms, suggesting a role of the bacteria in worm reproduction.

The branch uniting the fungi and animals is well - supported based on a number of molecular phylogenetic datasets, including the nuclear small subunit ribosomal RNA gene (Wainwright et al., 1993; Bruns et al. 1993), unique and shared sequence insertions in proteins such as elongation factor 1α (Baldauf and Palmer, 1993), entire mitochondrial genomes (Lang et al., 2002), and concatenated protein - coding genes (Steenkamp et al., 2006).

For expression analysis in mice, we used microarray data as described above to select two internal control genes, cyclophilin B (Cphn2) and ribosomal protein S3 (Rps3).

Ribosomal protein S24 (RPS24) gene served as an internal control for quantitation using the primer set TGGCTTTGGCATGATTTATGAT and CTTTTTGCCAGCACCAACATT.

In vivo studies have previously shown that Saccharomyces cerevisiae ribosomal protein (RP) gene expression is controlled by the transcription factor repressor activator protein 1 (Rap1p) in a

Abbreviations: Aβ, amyloid β - peptide; AD, Alzheimer's disease; ALS, amyotrophic lateral sclerosis; Ambra1, activating molecule in Beclin -1-regulated autophagy; AMPK, AMP - activated protein kinase; APP, amyloid precursor protein; AR, androgen receptor; Atg, autophagy - related; AV, autophagic vacuole; Bcl, B - cell lymphoma; BH3, Bcl - 2 homology 3; CaMKKβ, Ca2 + - dependent protein kinase kinase β; CHMP2B, charged multivesicular body protein 2B; CMA, chaperone - mediated autophagy; 2 ′ 5 ′ ddA, 2 ′, 5 ′ - dideoxyadenosine; deptor, DEP - domain containing mTOR - interacting protein; DRPLA, dentatorubral pallidoluysian atrophy; 4E - BP1, translation initiation factor 4E - binding protein - 1; Epac, exchange protein directly activated by cAMP; ER, endoplasmic reticulum; ERK1 / 2, extracellular - signal - regulated kinase 1/2; ESCRT, endosomal sorting complex required for transport; FAD, familial AD; FDA, U.S. Food and Drug Administration; FIP200, focal adhesion kinase family - interacting protein of 200 kDa; FoxO3, forkhead box O3; FTD, frontotemporal dementia; FTD3, FTD linked to chromosome 3; GAP, GTPase - activating protein; GR, guanidine retinoid; GSK3, glycogen synthase kinase 3; HD, Huntington's disease; hiPSC, human induced pluripotent stem cell; hVps, mammalian vacuolar protein sorting homologue; IKK, inhibitor of nuclear factor κB kinase; IMPase, inositol monophosphatase; IP3R, Ins (1,4,5) P3 receptor; I1R, imidazoline - 1 receptor; JNK1, c - Jun N - terminal kinase 1; LC3, light chain 3; LD, Lafora disease; L - NAME, NG - nitro - L - arginine methyl ester; LRRK2, leucine - rich repeat kinase 2; MIPS, myo - inositol -1-phosphate synthase; mLST8, mammalian lethal with SEC13 protein 8; MND, motor neuron disease; mTOR, mammalian target of rapamycin; mTORC, mTOR complex; MVB, multivesicular body; NAC, N - acetylcysteine; NBR1, neighbour of BRCA1 gene 1; NOS, nitric oxide synthase; p70S6K, ribosomal protein S6 kinase - 1; PD, Parkinson's disease; PDK1, phosphoinositide - dependent kinase 1; PE, phosphatidylethanolamine; PI3K, phosphoinositide 3 - kinase; PI3KC1a, class Ia PI3K; PI3KC3, class III PI3K; PI3KK, PI3K - related protein kinase; PINK1, PTEN - induced kinase 1; PKA, protein kinase A; PLC, phospholipase C; polyQ, polyglutamine; PS, presenilin; PTEN, phosphatase and tensin homologue deleted from chromosome 10; Rag, Ras - related GTP - binding protein; raptor, regulatory - associated protein of mTOR; Rheb, Ras homologue enriched in brain; rictor, rapamycin - insensitive companion of mTOR; SBMA, spinobulbar muscular atrophy; SCA, spinocerebellar ataxia; SLC, solute carrier; SMER, small - molecule enhancer of rapamycin; SMIR, small - molecule inhibitor of rapamycin; SNARE, N - ethylmaleimide - sensitive factor - attachment protein receptor; SOD1, copper / zinc superoxide dismutase 1; TFEB, transcription factor EB; TOR, target of rapamycin; TSC, tuberous sclerosis complex; ULK1, UNC -51-like kinase 1; UVRAG, UV irradiation resistance - associated gene; VAMP, vesicle - associated membrane protein; v - ATPase, vacuolar H + - ATPase; Vps, vacuolar protein sorting

High levels of gene expression were found in both strains for genes involved in growth, energy and respiration (e.g., ribosomal proteins, ATP synthase, pseudoazurin), and the C - 1 metabolic carbon such as methanol dehydrogenase, ribulose monophosphate enzymes (D - arabino -3-hexulose 6 - phosphate formaldehyde - lyase, 6 - phospho -3-hexuloisomerase), formaldehyde activating enzymes (Data S6, Fig.