Sentences with phrase «spe with»

More common is a bank or other entity creates an SPE with the specific purpose to...

The banks can generally get a better return from the bonds sold by the SPE with less effort.

Vatican II bore all the marks of that tension — especially in Gaudium et Spes with phrases like «the autonomy of earthly affairs» and «the signs of the times», which we see surface in such intercessions as «Teach us to work for the good of all, whether the time is right or not».

Not exact matches

But doesn't the image of the Church as a «fortified city», taken from the Old Testament, conflict with the spirit of Lumen Gentium, the Vatican II dogmatic constitution on the Church, and Gaudium et Spes, the Pastoral Constitution the Church in the Modern World?

It «imposes itself, quietly and with force» (Gaudium et spes).

Gaudium et Spes (50) teaches that, in exercising responsible parenthood, married couples will act with docile reverence toward God.

The Lineamenti point out that, through recent projects such as the Courtyard of the Gentiles, Pope Benedict has tried to promote that respectful engagement with secular opinion - formers that Vatican II encouraged so strongly in Gaudium et Spes, one of the concluding - and most controversial - documents of the Council.

And in his 2007 encyclical Spe Salvi, he argues that the measure of any culture is the degree to which it can identify with the suffering of the downtrodden.

So that when a couple or a mother that wishes to be a single mom, decides to combine her stored egg with a husband, boyfriend or donors spe «rm, the chances of a healthy and wanted baby increase greatly and the pregnancy due to r «ape argument goes out the window as well.

[2] This implies a hermeneutic of continuity and renewal, and thus a foundation of doctrinal orthodoxy, but also a genuine engagement with the modern world and culture (Gaudium et Spes).

[5] An «interior» or «subjective attitude»: cf. Benedict XVI, Spe Salvi, 7 [6] Here too Abraham is given as the exemplar of a man with faith.

However, in order for the Church to show itself «the sign of that brotherliness which allows honest dialogue» among all human beings, it will be necessary «to foster within the Church itself... dialogue with ever abounding fruitfulness» (Gaudium et spes 92).

It makes dialogue in the Church more difficult, and it can hardly be reconciled with the following recommendation of Vatican II: «Let there be unity in what is necessary, freedom in what is doubtful, and charity in everything» (Gaudium et spes 92).

Nec spe — nec metu (Do not hope — do not fear) Spinozist wisdom will say with equal emphasis.

The council itself teaches this lesson with great clarity in Gaudium et Spes: It is the task of the Church «to distinguish the many voices of our times and to interpret them in the light of the divine Word» — and not the other way around.

The Constitution on the Church in the Modern World of the Second Vatican Council Gaudium et Spes sums up the perspective with the arresting statement: «The Church believes that the key, the centre and the purpose of the whole of man's history is to be found in its Lord and Master».

It is hard to square it with the teaching of Gaudium et Spes.

During these two years, most of the influential texts of the council were forged into their final form: the Constitutions on the Church (Lumen Gentium), divine revelation (Dei Verbum), and the Church in the modern world (Gaudium et Spes), along with the decree on ecumenism (Unitatis Redintegratio) and the declarations on religious liberty (Dignitatis Humanae) and on the Church and non-Christian religions (Nostra Aetate).

... «With the help of the Holy Spirit, it is for the whole people of God, particularly its pastors and theologians, to listen to and distinguish the many voices of our times and to interpret them in the light of the divine Word, so that the revealed truth may be more deeply penetrated, better understood, and more suitably presented» [Gaudium et Spes, 44].

The years following the Second Vatican Council... Catholic theology has sought to follow the path opened by the Council, which wished to express its «solidarity and respectful affection for the whole human family» by entering into dialogue with it and offering «the saving resources which the Church has received from its founder under the promptings of the Holy Spirit» [Gaudium et Spes, 3].

Above all, though, Paul VI's concern and care for the family is expressed at length in the Council's Pastoral Constitution on the Church in the Modern World, Gaudium et Spes, which notes that «the well - being of the individual person and of human and Christian society is intimately linked with the healthy condition of that community produced by marriage and family».

As in the other chapters in which empirical evidence is considered, relevant findings from general communication research will be considered along with research focused spe - cifically on aspects of religious television.

On one occasion a «traditionalist» magazine entitled its first page with the headline «Let Us Forget Gaudium et Spes.»

See our list of the most popular U.S. Latino baby names compared with the top 10 names for Hispanic babies in other Spanish - spe...

SPE - 39 family proteins interact with the HOPS complex and function in lysosomal delivery.

Confocal images were obtained with a Leica SPE or an Olympus FV 1000 microscope.

The downstream sequences were PCR - amplified using a primer with an introduced Spe I site corresponding to the start of the 3» untranslated region at nucleotide 11,704 (UNC - 9C: 5» - TTACTAGTTGACACACCCCAACTTCGTAGC), and a primer at nucleotides 12,836 — 12,860 (UNC - 9D: 5» - CTAGTCTTTGCAGAGCAAGTGAGG - 3»).

CSF proteins (from the immunoaffinity depletion processed pooled samples and the individual samples without immunoaffinity depletion processing) were digested with trypsin and cleaned up with SPE C18 columns as previously described [10].

Its powerful performance with 350 watts and 12 spe... eds masterfully mixes through batters and dough to help prepare your foods to perfection.

well I am cheerful and open, interesting and tender, perfectly loyal and loving woman, who is fully trustful in relationships, and I'm very romantic, curious, kind hearted - and I dream about love and passion with my spe..

Jul 12, · Best Answer: first base = kissing second base = caressing What Is Third Base In Dating Terms The definition, (used, especially before a noun, with a spe...

The Stanford prison experiment (SPE) was an attempt to investigate the psychological effects of perceived power, focusing on the struggle between prisoners Prison guard Faron Selvage, 21, is alleged to have enjoyed a lesbian fling with inmate Sydnee Offord, 29, who claims she was «groped and kissed» by the

Regular Cab Ram with 20 Chrome Wheels, Paint to Match Bumpers, Front Armrest w / Three Cupholders, Front Center Armrest, Fully automatic headlights, Spe...

Magnetic Metallic 2015 Ford Flex SEL FWD 6 - Speed Automatic with Select - Shift 3.5 L V6 Ti - VCT 110V Power Outlet, Adjustable Pedals w / Memory, BLIS Blind Spot Monitoring System, Body - Color Liftgate Applique, Equipment Group 202A, Exterior Mirrors w / Security Approach Lamps, Factory Warranty Remaining, Leather - Trimmed Heated Bucket Seats, Memory Drivers Seat, Power Liftgate, Premium Audio System w / 7 Spe

This SUV is nicely equipped with features such as 9 Spe...

My current thought is maybe the parent company of the SPE wants to make a profit by investing in undervalued loans (the loan is considered by the seller to default but SPE doesn't agree with such expectation) while maintaining a relatively low financing cost (maybe SPE has a low financing cost due to its parent's strong - rating or maybe due to a sudden plunge of yield in bond market).

I held off of SPE for a really long time because of the converts and now with them out of the way..

I have been vaguely following SPE for a while after reading an interview with Phil and had put the name in my «to - look - at» file with thoughts of investing.

The Rosewood's 189 guest rooms and suites are done in quiet luxury, with soothing accents of natural wood and spe - like bathrooms with both a soaking tub and walk - in rainfall shower.

The PS3's architecture was Power PC with 7 Spe Processing graphic acceleration Processors..

A software solution for PS3 backwards compatibility is not really feasible to do such without heavy investing and without many of the games that relied on the SPE processors of the PS3 to have to be recoded just to run at good frame rates... because you would have to use the PS4's very own graphics processor to split it's workload because remember the PS3's SPE processors were direct on the die with a direct token ring of 204 GHz persec throughput... There is no token ring elements control bit, thus it would have to be simulated in the GPU of the PS4 and than add in the PS4's GPU having to also render it's own graphic processing on top of simulation of the SPE's of the PS3... the PS4 is powerful but each of those SPE's are clicked in at over 3 Ghz!

and the PS3 version looks * EVEN MOAR * phenomenal thanks to the PS3's SPEs helping out with the deferred rendering which leaves the GPU to do other stuff.

On the occasion of Zhang Yunyao's solo exhibition at Perrotin in Hong Kong, we speak with him to find out what «NEC SPE, NEC METU» actually means

Hannah co-chaired the 2010 SPE National Conference, «Facing Diversity: Leveling the Playing Field in the Photographic Arts,» with Miriam Romais, and was the chair of the Northeast and MidAtlantic SPE Regional Conference, «Photographers + Publishing» in 2011.

Arri, L. E., D. Yee, W. D. Morgan, and M. W. Jeansomme, 1992, Modeling coalbed methane production with binary gas sorption: Society of Petroleum Engineers, SPE Paper 24363, p. 459472

The CME has given origin to SPE that reaches the peak simultaneously with the beginning of SSC (Fig. 11).

... Let's begin with a provocative excerpt from an article on the website run by the Society of Petroleum Engineers (SPE):

The CME has given origin to SPE which reaches the peak simultaneously with the beginning of SSC of a geomagnetic superstorm that occurred on 14 May 2005.

The peak of SPE (> 10 MeV) is 3140 (pfu) and occurs, approximately, with the interplanetary shock occurrence, this is a typical behavior of central meridian events.

SPEs and law firms, having demonstrated the ability to operate a limited number of different business models in an ethical manner, will be allowed to experiment with an even greater variety.