Sentences with phrase «using unc»

Using unc - 9 mutants and heterologous promoters, we showed that expression of UNC - 9 in B class motor neurons is necessary to rescue the localization of UNC - 7S expressed in AVB.

We are using unc - 7 as a means to understand how electrical synapses are specifically established between cell partners.

Not exact matches

The GFP - tagged isoform a (plasmid pCK28 -LCB- PW01A8.1:: W01A8.1 (a) synth:: gfp:: unc - 54 3 ′ UTR -RCB--RRB- was constructed by synthesizing the W01A8.1 a sequence with modified codons to allow protection from CRISPR / Cas9 targeted sgRNA and prepared as a GeneArt ® Strings ™ DNA Fragment from Invitrogen (Invitrogen, Carlsbad, California, USA) and cloned using GeneArt ® Seamless Cloning System (Invitrogen) into pPD95.75 (NeoR).

One rescued line, EH536, was maintained and used for genetic crosses involving unc - 9 (fc16).

Long - range unc - 9Δ:: gfp PCR products for micro-injections were similarly PCR - amplified from ligations using the UNC - 9A primer plus a primer specific to pPD95.77 (5» - TTGCTACAGGCATCGTGGTGTCACG - 3»).

Like unc - 7S:: gfp, this construct rescued forward locomotion in the absence of cosmid F56B12, and we postulated that M121 in exon IV (the canonical innexin start site) might be used to generate a shorter but functional UNC - 7S - like product (UNC - 7SR).

Using anti-GFP antibodies, two major protein bands, not present in wild - type, were detected in unc - 7 (e5) animals rescued with unc - 7S:: GFP + F56B12 (Figure 3H).

Other strains used included CB1377 daf - 6 (e1377) X and CW129 unc - 9 (fc16) X. For transformation rescue, SP1531 ncl - 1 (e1865) unc - 36 (e251) III was sometimes used; the ncl - 1 gene was incidental in these cases.

This product was similarly purified in a low - melt agarose gel and used at 1 ng / μl along with 50 ng / μl of the unc - 36 (+) cosmid derivative RIp16 (gift of L Lobel) for microinjection into unc - 36 -LRB--) animals.

Mosaic analysis of unc - 9 followed the same strategy used for unc - 7 [9].

(The cold sensitive unc - 7 (hs10) allele was originally used as the basis for defining the gene unc - 124 [50], and a heteroallelic interaction with unc - 7 was reported [21, 50].

Most unc - 7 genomic constructs were made using subcloned fragments derived from cosmids F09B12 and R07D5.