Sentences with phrase «allelic variant»

The allelic variant, RS3 334, is associated in men, but not women, with a lower bonding quality with the partner (characterized by lower scores on the partner bonding scale and a greater likelihood of reporting martial problems)(Walum et al., 2008).

Four dogs with this allele were DNA sequenced, and none contained the SNP of allelic variant 1.

Allelic variant 3 is an insertion of 24 nucleotides at position -78 of the canine Cox - 2 gene (CGCCTCCGCCTCCGCCTCCGCCGC).

Resistance - conferring mutations and allelic variants were not reliably identified.

Mutations are cataloged in OMIM in the Allelic Variants section of gene entries (see 1.2).

Most of the allelic variants represent disease - causing mutations.

By looking at your specific allelic variants of your HLA family of genes, genetic testing can help you determine if genetics play a role in your gluten sensitivity.

The human serotonin transporter gene linked polymorphism (5 - HTTLPR) shows ten novel allelic variants

Not exact matches

To identify common functional variants, the authors used an allelic transmission disequilibrium test (TDT), which determines if an allele is transmitted more (or less) than we'd expect by chance.

This project will inform genomic studies in SSA by providing a reference for allelic, haplotype and LD structure for common variants in populations not currently covered by HapMap and the 1000 Genomes projects.