Sentences with phrase «as luc»

Although there is a tendency to link McKinniss to painters such as Elizabeth Peyton and Karen Kilimnik — largely due to the confinement of much of their output to smaller scales — it is more enlightening to pair McKinniss with other contemporaneous practices such as Luc Tuyman's gray - scale, funereal politics, Pablo Bronstein's architectural Capriccios or Jamian Juliano - Villani's hyper - real painted patchworks.

We hope the exhibition will encourage more dialogue around Wróblewski and reaffirm his importance and contribution to contemporary European figurative painting; not only in relation to artists from Poland and the former Soviet Union, such as Wilhelm Sasnal, but also with regard to figures such as Luc Tuymans and Marlene Dumas.

As Luc Tuymans put it, «Painting is a way of thinking and constitutes an enormous archetypal pattern which artists constantly fall back upon.»

It contributed to the careers of some influential artists such as Luc Tuymans and Neo Rauch.

Kahrs» film - like color references the emotive palette seen in work such as Luc Tuymans» Gaskamer, but builds another narrative context that remains familiar but unidentifiable.

He began working at Foksal Gallery in 1988, curating exhibitions by such artists as Luc Tuymans, Franz West and Douglas Gordon.

While the town hosts a myriad of dining options, no trip to Siem Reap is complete without sampling authentic delicacies such as luc - lac (stir fried beef), fish amok, Khor pork with bamboo shoots.

Of course, no trip to Siem Reap is complete without sampling authentic delicacies such as luc - lac (stir fried beef), fish amok, and insect - based dishes (for the adventurous diners), which you can find at local markets, roadside vendors, and upmarket Khmer restaurants within the town centre.

Starring: Juliette Binoche as Vianne Rocher, Alfred Molina as Comte Paul de Reynaud, Johnny Depp as Roux, Carrie - Anne Moss as Caroline Clairmont, Judi Dench as Armande Voizin, Lena Olin as Josephine Muscat, Peter Stormare as Serge Muscat, John Wood as Guillaume Blerot, Leslie Caron as Madame Audel, Antonio Gil as Jean - Marc Drou, Hélène Cardona as Francoise Drou, Hugh O'Conor as Pere Henri, Aurelien Parent Koenig as Luc Clairmont, Victoire Thivisol as Anouk Rocher, Harrison Pratt as Dedou Drou, Gaelan Connell as Didi Drou, Elisabeth Commelin as Yvette Marceau, Ron Cook as Alphonse Marceau

Read more Flick Flack reviews, such as Luc Besson's VALERIAN AND THE CITY OF A THOUSAND PLANETS and Charlie Theron's ATOMIC BLONDE.

The posters for the movie, which hits theaters on November 30, feature Dolph Lundgren as Andrew Scott, Scott Adkins as John and Jean - Claude Van Damme as Luc Deveraux.

The movie covers some of the same ground as Luc Besson's «Lucy,» about what might happen if people started using their full brain capacity.

Not exact matches

Patrick Stewart as Captain Jean - Luc Picard, partially transformed into Locutus of Borg in episode «The Best of Both Worlds: Part II.»

While Marine Le Pen and the far - left candidate Jean - Luc Melenchon both presented themselves as outside the system during the first round of the campaign, both are seasoned political veterans.

«I don't ever want to run a team differently ever again because it's what we should be doing as leaders anyways,» Luc declares.

In his April 2013 paper entitled «The Returns on Investment Grade Diamonds», Luc Renneboog examines secondary market returns and risks of investment grade gems (white diamonds, colored diamonds and other gems such as sapphires, rubies, and emeralds).

Maybe it's not as present to our rational minds, and yet it is keeping us alive — as Jean - Luc Marion says, the love of God is a presence so enormous, so permeating, so thorough that it's mistaken for absence.

Radical Augustinians from Calvinists and Jansenists (including Pascal) through Kierkegaard and Catholic postmodernists such as Jean - Luc Marion emancipate this gesture of radical transcendence from the Platonic moorings still at work in Augustine.

Readers interested in a theoretical critique of animal rights as antiliberal would do well to consult Luc Ferry's 1992 work Le nouvel ordre ecologique (The New Ecological Order, scheduled to be published in translation by the University of Chicago Press in 1995).

For such thinkers as Jan Patocka, Emmanuel Levinas, Jacques Derrida, and, to a certain extent, Jean - Luc Marion, the highest ethical gesture is a sacrificial self - offering which expects no benefit in return.

The new company will combine the Edrington portfolio of The Macallan, Highland Park, The Famous Grouse, Cutty Sark, Brugal rum and Snow Leopard vodka with WEBB's portfolio of Disaronno, Tito's Handmade Vodka, Armand de Brignac, Licor 43, The Glenrothes and Tia Maria, as well as wines including Cupcake Vineyards, Ramon Bilbao, Luc Belaire and Mionetto.

In 1998 the Bulls had Joe Kleine, Luc Longley and Bill Wennington as their centers.

Patrick Marleau scored four goals when he last faced the Avalanche (as a member of the Sharks) on January 23, 2017 at Colorado, the first player with at least four goals in a road game versus the Avalanche since Luc Robitaille had four at Colorado on November 25, 1993 while playing for the Kings.

Those things happen to any team missing their three top defenders, as the Rockets are in Clint Capela, Chris Paul, and Luc Richard Mbah a Moute.

However, Ingram's first NBA points would come in the second quarter on a three - point attempt as he knocked it down in the face of Rockets forward Luc Mbah a Moute.

Bliss applied for and got the New Mexico job, and just before Longley went off to lead Australia to a semifinal berth in the Seoul Olympics, Bliss paid a visit Down Under, as much to introduce himself to Richard as to Luc.

As part of a halftime contest at a game in Albuquerque in January 1989, Richard, who for the first time was watching Luc play for the Lobos, came out of the stands, ripped off his dress shirt and swished a shot from half - court.

Longley grew up in Fremantle, and on the night of Dec. 7 he seemed for all the world as if he were back there again rather than where he actually was, on his adopted home court in Albuquerque, playing against New Mexico's archrival, New Mexico State, and enduring scandalously rude taunts from several of what Long Luc calls «sepos.»

Meanwhile, Dalglish is rumoured to have made a loan offer for Inter Milanâ $ ™ s 19 - year - old forward Luc Castaignos, who the manager wants to act as cover for Suarez during his suspension.

Seeing their wide - eyed wonder makes it hard not to think back to your own first game, especially when the arena lights dim and the intro music («Sirius» by Alan Parsons Project) begins, bringing with it some serious goosebumps as memories of Bulls legends — Michael Jordan, Scottie Pippen, Luc Longley, Toni Kukoc and Dennis Rodman — come flooding back.

Jean - Luc Rivera, Program Director (Camp Name «Tuba») Jean - Luc joined the Camp Kesem National team in 2017 as a Regional Program Director.

I realized too late last year that we should have dressed our then - bald geek - baby as Jean - Luc Picard.

However, instead of viewing their teething as double trouble, Dubray — who also has a 4-1/2 - year - old son, Luc — takes solace in having a little more veteran's know - how this time around: «Teething with the twins has been easier since I understood it from having a child before,» she says.

Jean - Luc joined the Camp Kesem National team in 2017 as a Regional Program Director.

To have my own little massage space in a building might be wishful thinking for 2017 but as the quote goes `' The most absurd aspirations have sometimes led to extraordinary success» - Luc Di Clapiers.

In order to be clear, Alain Juppé is from the Republicans party, Marine Le Pen from the Front National (nationalists), François Hollande is from the Socialist party and Jean - Luc Mélenchon from what is refereed to as»...

The after effect of the review of the amended LUC law means owners of property in Lagos State can now reap the benefits and waivers as follows:

In line with the administration's tradition of inclusive governance and civic engagement, the Lagos State Government on Thursday, March 15 announced the downward review of the amended Land Use Charge Law 2018 to 50 % for commercial property as well as other LUC waivers that will give economic succour to owners of property and taxpayers in Lagos State.

Similarly, Mr. Thomas Aderinola, a real estate investor in Lagos State, said the downward review of the amended LUC law by as much as 50 % was a reassuring indication that the LASG is a listening government.

At the convention of the movement on 25 November 2017, Jean - Luc Mélenchon announced that La France Insoumise would present a list in 2019 as «L'Europe Insoumise».

As a Ph.D. student, Vermeulen was «an extremely motivated scientist, really striving to do things very well... and trying to reach [his] goals,» says Luc De Meester, a former colleague of Vermeulen's who today is a full professor in the department of biology at the University of Leuven.

Transplant tourism today accounts for as much as 10 percent of all donor kidneys transplanted, says Luc Noël, coordinator for Essential Health Technologies at the World Health Organization (WHO).

As first noted more than a decade ago by astronomer Luc F. A. Arnold, particularly large panels or groups of panels flying in formation — even bigger, perhaps, than the star itself — would cause huge, discrete dips related to their geometric shape as they transiteAs first noted more than a decade ago by astronomer Luc F. A. Arnold, particularly large panels or groups of panels flying in formation — even bigger, perhaps, than the star itself — would cause huge, discrete dips related to their geometric shape as they transiteas they transited.

«I am pleased my long - time friend and colleague Dr. Luc Montagnier, as well as his colleague Francoise Barre - Sinoussi, have received this honor,» Gallo, co-director of the Institute of Human Virology at the University of Maryland School of Medicine, said in a statement afternoon.

He shared the medicine Nobel with Luc Montagnier and Francoise Barre - Sinoussi who discovered that the immunodeficiency syndrome now known as AIDS was caused by HIV.

p21waf1 / cip1 promoter — driven luciferase reporter (p21 - Luc; 0.05 - 0.5 μg) and increasing amount (0.1 - 2 μg) of FLAG - DDX3 expression construct were cotransfected into various cell lines as indicated.

Land degradation in the drylands, commonly known as desertification, begins with the clearing of vegetation, which means «forests are the first step towards healing the drylands and protecting them from desertification and drought,» as Mr. Luc Gnacadja, Executive Secretary of the United Nations Convention to Combat Desertification (UNCCD) observes.

Most low - emission scenarios involve substantial land - use change (LUC) including the expansion of bioenergy and food crops, as well as afforestation.

Evidence of a temperature problem similar in the NLR as in HII regions Luc Binette 2018 April 17, 13:30 IA / U.

Nucleotide duplexes for luciferase (LUC; CAAATCACAGAATCGTCGTAT, clone ID TRCN0000072246) and green fluorescence protein (GFP; TATCATGGCCGACAAGCA, clone ID: TRCN0000072180) were used as controls for viral infection.