Sentences with phrase «as unc»

Additionally, six were identified as Unc - 9 non-Rubberband non-Dyf, giving rise to both wild - type and Unc Rubberband progeny.

A: Myself and several others from Penn Medicine have been serving as UNCs for about five years.

Not exact matches

As others have said, this state is a bad joke and the media and institutional powers can not be trusted when it comes to UnC - Ch or NC State.

The GFP - tagged isoform a (plasmid pCK28 -LCB- PW01A8.1:: W01A8.1 (a) synth:: gfp:: unc - 54 3 ′ UTR -RCB--RRB- was constructed by synthesizing the W01A8.1 a sequence with modified codons to allow protection from CRISPR / Cas9 targeted sgRNA and prepared as a GeneArt ® Strings ™ DNA Fragment from Invitrogen (Invitrogen, Carlsbad, California, USA) and cloned using GeneArt ® Seamless Cloning System (Invitrogen) into pPD95.75 (NeoR).

Other presumptive promoters tested included that for sra - 11 (Psra - 11:: unc - 7S:: gfp), inserted as a 5.1 - kb Bam HI fragment (amplified with primers 5» - AGACTTCGACAGTTCAAGCTCTCGG - 3» and 5» - GTTGTCATGGATCCTAGCTGAAATATAAGGG - 3») and micro-injected at 10 — 100 ng / μl; acr - 5 (Pacr - 5:: unc - 7S;; gfp), inserted as a 4.4 - kb Sac II / Bam HI fragment (primers 5» - GAGAAAGAGAAGCGCCGCGGCTCAG - 3» and 5» - ACTCTGCTACCGGATCCACAGGAGC - 3») and micro-injected at 10 — 25 ng / μl; and cex - 1 (Pcex - 1:: unc - 7S:: gfp), inserted as a 1 - kb Sac II / Bam HI fragment (primers 5» - CCGCGGTTTGTCGTGTTCCAAACAGAAGC - 3» and 5» - TGCAACAACCAATTCTGAAAGTATAAGATTTGACTG - 3») and micro-injected at 100 ng / μl.

We will refer to the predicted products of the unc - 7 rescuing transcript as UNC - 7S with the understanding that UNC - 7SR is also translated.

We are using unc - 7 as a means to understand how electrical synapses are specifically established between cell partners.

The 5» end of unc - 7S was identified as an SL1 - spliced product with 94 nucleotides found in intron 3 (nucleotides 12,452 - 12,359) serving as exon 1.

Therefore, the Unc - 7 locomotory defect reflects loss of unc - 7 gap junction channel function, regardless of ectopic gap junction formation, and we sought to determine which gap junctions in the nervous system include UNC - 7 as a componeUnc - 7 locomotory defect reflects loss of unc - 7 gap junction channel function, regardless of ectopic gap junction formation, and we sought to determine which gap junctions in the nervous system include UNC - 7 as a componeunc - 7 gap junction channel function, regardless of ectopic gap junction formation, and we sought to determine which gap junctions in the nervous system include UNC - 7 as a componeUNC - 7 as a component.

(The cold sensitive unc - 7 (hs10) allele was originally used as the basis for defining the gene unc - 124 [50], and a heteroallelic interaction with unc - 7 was reported [21, 50].

unc - 124 (hs10) was originally isolated as a cold - sensitive (cs) unc mapping to the left arm of chromosome X between dpy - 8 and unc - 10, at approximately 2.4 cM [50]; unc - 7 maps to the right arm of X at +22 cM.

GFP was seen in puncta near B class motor neuron cell bodies (Figure 7G), although these were generally not as pronounced as with unc - 7S:: gfp.

Punc - 7S:: unc - 9:: gfp was expressed in unc - 7 (e5) mutants; UNC - 9:: GFP was broadly but weakly expressed as small puncta throughout the ventral nerve cord (Figure 7J), a pattern reminiscent of UNC - 7S expression in unc - 9 unc - 7 double mutants (Figure 7D).

It also suggests that in unc - 9 mutants, the native UNC - 7 isoforms expressed in motor neurons (as detected by previous analysis of total UNC - 7 expression) are insufficient to properly localize AVB - expressed UNC - 7S:: GFP (that is, UNC - 7 in motor neurons does not substitute for UNC - 9 in localizing AVB - expressed UNC - 7S).

we did not discover information about Pet stores in Kannapolis, Unc Charlotte and Providence, but select Pet stores in North Carolina such as Country Tack & Outfitters, placed in