Sentences with phrase «as in a specific gene»

Not exact matches

Only in the past decade has RNA been discovered to carry out a wide variety of specific tasks in genetics, such as turning particular genes on or off.

Luxturna is the first of a crop of treatments that target diseases caused by mutations in specific genes, and thus is referred to by many as the first gene therapy in the U.S.

The advance is based on a technique that allows scientists to narrow in on a specific gene and cut - and - paste bits of DNA to change its function, known as CRISPR - Cas9.

It has been estimated that 5 % to 10 % of infants who die from SIDS have novel mutations in the cardiac sodium or potassium channel genes that result in long QT syndrome as well as in other genes that regulate channel function.44 A recent report described important new molecular and functional evidence that implicates specific SCN5A (sodium channel gene) β subunits in SIDS pathogenesis.47 The identification of polymorphisms in genes pertinent to the embryologic origin of the autonomic nervous system in SIDS cases also lends support to the hypothesis that a genetic predisposition contributes to the etiology of SIDS.

Genetically modified crops are plants in which genes are altered in the laboratory to make them perform in a very specific way, such as not being harmed by certain herbicides.

The quantity of ctDNA, as well as the emergence of specific gene mutations, could be used in the future to steer therapy in a more precise manner.

She went online to buy E. coli, DNA, plasmids (self - replicating particles used to transport genes into foreign organisms), biochemical compounds, and restriction enzymes (proteins that serve as infinitesimal scissors to clip DNA in specific regions).

Scientists had been searching in vain for such a gene since 1994 when Rockefeller University scientist Jeffery Friedman found that lab mice with a specific genetic mutation fail to produce leptin and as a result have uncontrollable appetites, and become huge.

Using a combination of old - fashioned clinical observation and modern biochemical analysis, he has shown that a person's appetite and their eating behavior can be linked to specific genes — and that even a tiny defect such as the absence of a single nucleic acid in a sequence of DNA can lead to runaway weight gain.

After extensive analysis of this new gene, the team discovered that moc1 functions as a chloroplast - specific «Holliday junction resolvase», which Nishimura continues, «is very important in untangling a DNA structure called Holliday junctions.

Earlier MD Anderson investigations demonstrated exosomes as a factor in detecting pancreatic cancer, but these latest findings reveal genetically altered exosomes as a potentially novel approach for direct and specific targeting of mutated KRAS, the cancer gene commonly linked to pancreatic cancer.

Private funders such as the Bill and Melinda Gates Foundation, in Seattle, Washington, and the Tata Trusts, a Mumbai - based charity, have spent tens of millions on gene - drive research, but this funding has been directed to specific projects or institutions; other government funders have not yet made large contributions to the field.

Since beginning a lab dedicated to understanding cancer metastasis at Rockefeller six years ago, Associate Professor Sohail Tavazoie has found that microRNAs — tiny strands of RNA that function as switches to inactivate specific genes — play an important role in controlling genes linked to metastasis.

Researchers use this natural defense mechanism in bacteria as the basis for the Crispr - Cas9 gene - editing system, creating synthetic guides to search out whichever specific string of DNA bases the researchers choose.

In those cells the Esrp1 and Esrp2 proteins enforce epithelial - specific splicing isoforms for hundreds of different genes, as Carstens and his team have shown in studies since 200In those cells the Esrp1 and Esrp2 proteins enforce epithelial - specific splicing isoforms for hundreds of different genes, as Carstens and his team have shown in studies since 200in studies since 2009.

Ongoing studies by investigators across the country, including Drs. Abraham Palmer and James MacKillop, who also participated in the conference, involve analysis of DNA and questionnaire responses from as many as 25,000 human subjects in order to identify specific genes involved in delay discounting.

In this study that used deep DNA sequencing of bacterial specific genes, the guts of both males and females exposed to lead had all of the similar complexity in microbiota as those not exposeIn this study that used deep DNA sequencing of bacterial specific genes, the guts of both males and females exposed to lead had all of the similar complexity in microbiota as those not exposein microbiota as those not exposed.

The findings highlight specific sets of genes and the brain cells they affect as being involved in regulating anxiety.

The gene produces an enzyme that, if inhibited via a specific drug therapy, could offer hope to patients prone to deep - vein clots, such as those that sometimes form in the legs during lengthy airplane flights or during recuperation after major surgery.

NIPD for single gene disorders in a fetus is diagnostic, as it targets specific genetic changes present in a high risk family.

«We searched for genes that are occasionally deleted in some cancers but which are retained in cancers caused by specific tumor suppressing genes, such as PTEN,» said Di Zhao, Ph.D., Odyssey postdoctoral fellow in Cancer Biology and first author on the Nature paper.

The genomics era has had a profound impact on life science research, leading to significant developments such as the use of expression quantitative trait loci (eQTLs), which link polymorphisms in single genes to quantifiable changes in gene expression associated with specific diseases.

The scientists investigated the parasite's microRNAs as they entered the host and discovered that microRNAs are shutting off specific genes in the host plant.

Tsigelny added: «The clinical treatments that do not take into consideration the specific mutations in genes, but rather treat all mutations within a specific gene such as EGFR as the same, are a «hit - or - miss» game because they are based solely on observational data on how other patients previously have reacted to drug therapies.»

The researchers also identified specific mutations in genes important in adaptation to factors such as climate and pathogens, including those involved in morphology, behaviour and innate immunity.

Because diseases can be endemic to specific regions of the world, these genes exist in thousands of versions, known as alleles.

Yet, while scientists have identified several genes that confer specific traits in these species that humans have bred or selected for, such as a special gait in horses, these «are not critical for domestication,» says Leif Andersson, a geneticist at Uppsala University in Sweden.

The researchers used tools of epigenomic analysis to trace the specific epigenetic switches controlling each of thousands of genes in both mouse and human retinal cells as the cells progressed through development.

By mapping the neural processes involved as birds learn mating songs, scientists hope to someday use that knowledge to target specific genes disrupting speech in patients with autism or other neurodevelopmental conditions.

The study supports the importance of the serotonin which is specified and maintained by a specific gene, the Pet - 1 gene — for normal functioning of the neurons, synapses and networks in the cortex, as well as proper development of brain circuitry.

In the lycopene experiment, Church did not know which modifications to make in the E. coli genes to get the result he wanted, but the technique could just as easily be used to introduce specific sets of changes into a genome, inserting and deleting hundreds or thousands of genes at oncIn the lycopene experiment, Church did not know which modifications to make in the E. coli genes to get the result he wanted, but the technique could just as easily be used to introduce specific sets of changes into a genome, inserting and deleting hundreds or thousands of genes at oncin the E. coli genes to get the result he wanted, but the technique could just as easily be used to introduce specific sets of changes into a genome, inserting and deleting hundreds or thousands of genes at once.

Going back to the tomato genome, the researchers identified specific genes responsible for the presence of these volatiles, as well as which heirloom varieties carried those genes, they report today in Science.

Working with Bhaduri, who has a background in statistics and bioinformatics, Pollen and Nowakowski began exploring how specific classes of neurons and stem cells in the developing brain contribute to normal brain growth as well as to neurodevelopmental disease, and have begun to build a comprehensive, open - source atlas of gene expression across the developing brain, which they hope will serve as a resource for other scientists.

In it, they sound the alarm about new genome - editing techniques known as CRISPR and zinc - finger nucleases that make it much easier for scientists to delete, add, or change specific genes.

Although it shows no sign of the whole - genome triplication identified in Solanaceae species such as tomato, the genome includes several species - specific gene family expansions, among them N - methyltransferases (NMTs) involved in caffeine production, defense - related genes, and alkaloid and flavonoid enzymes involved in secondary compound synthesis.

In humans, Galatzer - Levy found that different versions of the fkbp5 gene were able to predict specific differences in extinction learning related to PTSD symptoms such as reliving or re-experiencing the traumatic event; avoiding reminders of the event; and, in particular, hyperarousal, or the inability to sleep or concentratIn humans, Galatzer - Levy found that different versions of the fkbp5 gene were able to predict specific differences in extinction learning related to PTSD symptoms such as reliving or re-experiencing the traumatic event; avoiding reminders of the event; and, in particular, hyperarousal, or the inability to sleep or concentratin extinction learning related to PTSD symptoms such as reliving or re-experiencing the traumatic event; avoiding reminders of the event; and, in particular, hyperarousal, or the inability to sleep or concentratin particular, hyperarousal, or the inability to sleep or concentrate.

But the idea fell out of fashion as researchers began to discover that mutations in specific oncogenes and tumor - suppressor genes could set cancer in motion.

Apart from that, the team has managed to show that the ANKRD55 proteins reside in the nuclei of the cells, and that suggests that they could play a significant role in the specific processes that take place in the cell nucleus such as gene transcription.

Moreover, the ability to easily program sequence - specific DNA targeting and cleavage by CRISPR - Cas components, as demonstrated for Cas9 and Cpf1, allows for the application of CRISPR - Cas components as highly effective tools for genetic engineering and gene regulation in a wide range of eukaryotes and prokaryotes.

Our study sought to use a new way of imaging the lung to understand how well the drug is working in patients with a specific gene mutation known as G551D - CFTR.»

Because the ASHCEs in genes such as Sim1 were highly conserved and therefore largely unchanged by evolution since the dinosaur era, this suggests CREs such as ASHCEs were vital in developing bird - specific traits and may have driven the transition of dinosaurs to birds.

The ASHCE functions as an enhancer that regulates Sim1 gene expression in an avian - specific manner.

For instance, says Korenberg, the data could help scientists to link genes that seem important in certain mental disorders, such as schizophrenia or autism, to specific brain - wiring abnormalities.

Her dissertation looked at whether variants in the PSA gene — that is, the gene that codes for the PSA (prostate specific antigen) protein doctors use as a screen for the existence or recurrence of prostate cancer — had any influence on developing the cancer.

Scientists have discovered many points of regulation in the process of using a specific DNA template to make a protein, known as gene expression, that allow the cell to control how much of a certain protein is made at a certain time.

Briefly, the purified genomic DNA was used as a template to amplify a fragment of the cxcr4 gene using the specific primers (human CXCR4: 5 ′ - CAACCTCTACAGCAGTGTCCTCATC -3 ′ and 5 ′ - GGAGTGTGACAGCTTGGAGATG -3 ′; rhesus CXCR4: 5 ′ - GGTGGTCTATGTTGGAGTCTGG -3 ′ and 5 ′ - GGAGTGTGACAGCTTGGAGATG -3 ′) in the presence of a 32P - dATP and dCTP.

«RNAi therapies are a unique approach to cancer treatment as they have the potential to «turn off» the genes» coding for proteins involved in cancer cell division,» said Ramesh K. Ramanathan, M.D., medical director of the Virginia G. Piper Cancer Center Clinical Trials Program at Scottsdale Healthcare and deputy director of the Clinical Translational Research Division of the Translational Genomics Research Institute (TGen) in Phoenix, Ariz. «Using a lipid nanoparticle, the RNAi drug can be delivered to a cancer cell to block the expression of specific proteins involved in tumor growth.»

By analyzing variation in a specific bacterial gene in his samples — the greater the variability, the higher the variety of species — Fierer found that deserts contained up to twice as many bacterial species, roughly 10,000 per 10 square meters, as did acidic rain forest soils.

«This data allows classification of all human protein - coding genes into those coding for house - hold functions (present in all cells) and those that are tissue - specific genes with highly specialized expression in particular organs and tissues, such as kidney, liver, brain, heart, pancreas.

CRISPR / Cas systems are known as promising «gene scissors» in the genome editing of plants, animals, and microorganisms by targeting specific regions in their DNA - and perhaps they can even be used to correct genetic defects.