Sentences with phrase «as rhesus»

In June, the Scripps Research Institute published their work on a similar vaccine that was found to be effective in mice, as well as rhesus monkeys, and other opioid vaccines are also being developed and tested in order to address the growing epidemic.

Hauser himself, a professor of psychology, human evolutionary biology, and organismic and evolutionary biology at Harvard and codirector of the school's Mind / Brain / Behavior Initiative, has analyzed the antics of tamarins, vervet monkeys, macaques, and starlings in captivity, as well as rhesus monkeys and chimpanzees in the wild.

Zhang compared the DNA nucleotide sequence of the human version of ASPM to that of two of our great ape cousins, the chimpanzee and the orangutan, as well to more distantly related animals such as rhesus monkeys, seals, dogs, and hamsters.

GOING VIRAL The diversity of viruses carried by such animals as rhesus macaques (one shown) hints at the number of viruses capable of infecting humans that are yet to be discovered.

Not exact matches

Zoologist Robert Hinde conducted several experiments with rhesus monkeys in which he studied their emotional and behavioural reactions to separation from their mothers, as well as their interactions with other monkeys.

Using young rhesus monkeys in our model of anxious temperament is critical as brain structure and function in non-human primates closely resembles that of humans.»

The research team made its findings by recording and analyzing the neural activity in the ventral premotor cortex of three trained rhesus macaques as they participated in a series of grip tasks.

The team of scientists collected more than 250 facial images of free - ranging rhesus macaques, which are native to South, Central and Southeast Asia and which display red skin coloring around the face, as well as the genital and hind - quarter areas.

The sophistication of these systems in infants resembles that of modules in nonhuman primates, suggesting an ancient, evolutionary development; a six - month - old baby understands numbers, space, objects and faces much as a mature rhesus monkey does.

To understand further the neuropathologic effects of Bb infection, researchers infected 12 rhesus macaques with live B. burgdorferi; two animals were left uninfected as controls.

Eight of eight rhesus macaques did so as well.

First author Siddharth Krishnamurthy and the team, including Dan Barouch, MD, PhD, Beth Israel Deaconess Medical Center and Harvard Medical School, identified RNA bacteriophages by analyzing data from oceans, sewage, soils, crabs, sponges and barnacles, as well as insects, mice and rhesus macaques.

Falk reasoned that the extra neurons of men and rhesus males are most likely dedicated to visual - spatial skills, such as map reading, distinguishing between left and right, and mentally rotating figures — all abilities useful for navigating uncharted territories in search of mates.

In September a 25 - year study conducted by the National Institute on Aging, in Baltimore, found that rhesus monkeys fed a moderate diet lived just as long as those receiving 25 to 30 percent fewer calories.

The researchers administered a potential vaccine consisting of two components to twelve rhesus monkeys that served as an animal model for the human HIV infection.

There's the clutching reaction of the rhesus monkey, in which the female generally reaches back with one hand and grasps the male, sometimes turning and looking over her shoulder at the presumed moment of his climax — which, if it does indicate a female eruption as well, would leave people in the dust when it comes to simultaneous orgasms.

Luis Barreiro at the University of Montreal, Canada, and colleagues sorted female rhesus monkeys who had never met into groups and observed as they formed a social pecking order.

As the American human spaceflight program began to build momentum, the nation started experimenting with chimpanzees, which are larger and more closely related to humans than are rhesus, squirrel or other monkeys.

In addition, we checked for TMAdV in rectal swab samples from rhesus macaques housed in the same building as the titi monkeys (n = 26) and in pooled droppings from wild rodents (n = 2) living near the titi monkey cages.

As I know from my work with free - ranging infant wild baboons in Kenya — monkeys that have a social organization similar to that of the rhesus — this regimen results in a terrible distortion of the animals» natural way of life.

Briefly, the purified genomic DNA was used as a template to amplify a fragment of the cxcr4 gene using the specific primers (human CXCR4: 5 ′ - CAACCTCTACAGCAGTGTCCTCATC -3 ′ and 5 ′ - GGAGTGTGACAGCTTGGAGATG -3 ′; rhesus CXCR4: 5 ′ - GGTGGTCTATGTTGGAGTCTGG -3 ′ and 5 ′ - GGAGTGTGACAGCTTGGAGATG -3 ′) in the presence of a 32P - dATP and dCTP.

A549 (human lung adenocarcinoma) and BSC - 1 (African green monkey kidney epithelial) cell lines as well as PMK (primary rhesus monkey kidney) cells are routinely maintained at the Viral and Rickettsial Disease Laboratory (VRDL) branch of the California Department of Public Health.

As the 24 bp X4 - ZFPs» binding site is identical between rhesus and humans, we were able to utilize the same ZFN pair.

Despite its canine focus, the Soviet Union and its successor state Russia did launch a number of rhesus monkeys to space in the 1980s and 1990s, as part of a program called Bion.

Projects utilizing cynomolgus or rhesus monkeys can be initiated on short lead times, as a pool of quarantined animals is maintained on the premises.

According to the researchers, rhesus monkeys are often employed in brain research as models for humans.

The researchers, led by UW — Madison pathology Professor David O'Connor, published a study today (June 28, 2016) in the journal Nature Communications describing their work establishing rhesus macaque monkeys at the Wisconsin National Primate Research Center as a model for studying the way Zika virus infections may progress in people.

While mice, guinea pigs, dogs, rabbits and monkeys have been used as animal models to study B. burgdorferi infection, rhesus macaques have been shown to most closely recapitulate the multi-organ nature and progression of human LD [26, 27].

Amazon frogs, rhesus monkeys, anything will do as He courts Her.

As soon as Kaidanov unlocked the front door of the building the rhesus monkeys started making that half - cooing, half - barking sound that set his nerves on edgAs soon as Kaidanov unlocked the front door of the building the rhesus monkeys started making that half - cooing, half - barking sound that set his nerves on edgas Kaidanov unlocked the front door of the building the rhesus monkeys started making that half - cooing, half - barking sound that set his nerves on edge.

CRH haplotype as a factor influencing cerebrospinal fluid levels of corticotropin - releasing hormone, hypothalamic - pituitary - adrenal axis activity, temperament, and alcohol consumption in rhesus macaques