Sentences with phrase «at nucleotide»

In Irish Setters, rcd1 is caused by a nonsense mutation G > A transition at nucleotide position 2420 in PDEB gene.

Derivatives of this basic construct included removal of the alternative exon 4 by deleting an Nhe I / Apa I fragment (nucleotides 12,259 — 12,543; Figure 3D); replacement of the genomic region covering exons 2 — 6 with the corresponding cDNA sequence (Sal I to Nco I; nucleotides 14,412 — 11,736; Figure 3E) plus additional upstream sequence to allow for recombination with F56B12 (to the Xho I site at nucleotide 15,574); and introduction of a Met to Leu mutation (M121L, ATG to CTG) by PCR amplification with primers that included the sequence change (nucleotides 11,968 — 11,970; Figure 3F).

The downstream sequences were PCR - amplified using a primer with an introduced Spe I site corresponding to the start of the 3» untranslated region at nucleotide 11,704 (UNC - 9C: 5» - TTACTAGTTGACACACCCCAACTTCGTAGC), and a primer at nucleotides 12,836 — 12,860 (UNC - 9D: 5» - CTAGTCTTTGCAGAGCAAGTGAGG - 3»).

The pathogenic stop gain in p.R259fs allele is at nucleotide 1,050, noted with red arrow.

Identification of significant phylogenetically informative sites at the nucleotide level revealed positions not only contributing to clade differentiation, but which are located at or proximal to codons associated with resistance to protease inhibitors (NS3 Q41) or polymerase inhibitors (NS5B S368).

FRT sites and loxP sites differ at the nucleotide level but share an overall structure of 13 base pair palindromic repeats separated by an 8 bp asymmetric core.

The excision products (26 — 34 nucleotides in length) were visualised at nucleotide resolution on a denaturing polyacrylamide gel as indicated.

At the nucleotide level the B9 and A14 precursor Vg shares 69.83 % identity with VH1 - 2 * 02 as while B9 and A14 are 68.84 and 68.73 % identical respectively.

For inx - 19, an Xho I site was introduced at nucleotides 11,041 — 11,046 (of cosmid T16H5) in a plasmid that included 1,565 nucleotides 5» and 2,042 nucleotides 3» to this site.

Not exact matches

At the Salk Inst.itute for Biological Studies, in 1994, Leslie Orgel observes, «Because synthesizing nucleotides and achieving replication of RNA under plausible prebiotic conditions have proved so challenging, chemists are increasingly considering the possibility that RNA was not the first self replicating molecule...» (9).

Interestingly, the ratios of each of the components change throughout the day to offer the most energy during the daylight hours and the highest concentrations of sleep - inducing nucleotides during nighttime feeding, so if a mama is pumping and storing breastmilk, it's important to label the time of day the milk was pumped to avoid giving the more stimulating daytime milk at night!

Naturally occurring chemicals called nucleotides that have previously been linked to sleepiness only reach their highest concentrations in human breast milk that is expressed at night.

«This is really the first time we've gone from risk variants highlighted by GWAS to a mechanistic and molecular understanding — right down to the nucleotide — of how a mutation can contribute to the risk of developing disease,» says Whitehead Founding Member Rudolf Jaenisch, who is also a professor of biology at MIT.

The collaboration began after co-author Dr Rupert Fray's group at the University of Nottingham found that a plant enzyme required for putting the modified nucleotide into Arabidopsis mRNA interacted with the plant version of the Drosophila sex determination factor FEMALE - LETHAL (2) D.

Cytidines or uridines are added to C5 to generate chain lengths of 10 to 11 nucleotides, with longer products being generated at greatly reduced efficiency.

The nucleotide in M1 RNA, residue C92, which participates in a crosslink with the substrate was deleted and the resulting mutant M1 RNA was shown to cleave substrates lacking the 3» terminal CCAUCA sequence at sites several nucleotides away from the normal site of cleavage.

The researchers determined that CRISPR had successfully corrected a gene that causes blindness, but Kellie Schaefer, a PhD student in the lab of Vinit Mahajan, MD, PhD, associate professor of ophthalmology at Stanford University, and co-author of the study, found that the genomes of two independent gene therapy recipients had sustained more than 1,500 single - nucleotide mutations and more than 100 larger deletions and insertions.

Analysis of maternal liver at the time of fetal resorption indicates that the observed effects may be mediated through modification of the concentration of the pyridine nucleotide coenzymes.

«We feel it's critical that the scientific community consider the potential hazards of all off - target mutations caused by CRISPR, including single nucleotide mutations and mutations in non-coding regions of the genome,» says co-author Stephen Tsang, MD, PhD, the Laszlo T. Bito Associate Professor of Ophthalmology and associate professor of pathology and cell biology at Columbia University Medical Center, and in Columbia's Institute of Genomic Medicine and the Institute of Human Nutrition.

By binding to a stem structure formed by uracil and adenine nucleotides in the nanos RNA, Glo prevents the production of Nanos protein at the front of the embryo, a step that enables the fly's head to form properly.

«We're able to see at the molecular level down to a single nucleotide and then we have the view from the very top.

This database is produced at National Center for Biotechnology Information (NCBI) as part of the International Nucleotide Sequence Database Collaboration, or INSDC.

Fully sequenced genomes remain rare, so the bulk of the analysis was done by looking at genetic markers known as single nucleotide polymorphisms or SNPs.

Reviewing thousands of genome wide associate studies (GWAS) to identify genetic variants in single nucleotide polymorphisms (SNPs), investigators at Dartmouth's Norris Cotton Cancer Center found that some alleles (one of a pair of genes located on a specific chromosome) are more frequently risk - associated with disease than protective.

In this latest study, she and her group used cryo - EM, in which protein samples are flash - frozen at liquid nitrogen temperatures to preserve their natural structure, to determine microtubule structures in different nucleotide states with and without EB3.

The research team's hunt for such age - related genetic associations involved studying more than 8 million single nucleotide polymorphisms — changes of one nucleotide for another at a particular spot in the DNA — in 2,693 individuals.

The European Nucleotide Archive, launched on May 10 at the European Molecular Biology Laboratory's European Bioinformatics Institute in Cambridge, UK, will also offer labs free remote storage of their genome data and use of bioinformatics tools.

The research looked at more than five million genetic variations, called single nucleotide polymorphisms or SNPs (pronounced «snips»), in each participant in the study and compared the frequency of these SNPs with that of the control subjects.

It is unclear how the entire body is affected because Spector looked only at telomeres, nucleotides on the ends of chromosomes that slowly erode as cells copy themselves during normal aging.

One commercially available alternative is pyrosequencing, which also detects nucleotides as they are added to a single strand of DNA, but it can lead to errors because it is harder to differentiate between a single base and a whole stretch of identical bases next to each other, says Elaine Mardis, a geneticist at Washington University in St Louis, US.

Next they copied the promising RNA molecules using a technique that caused small mutations in their nucleotide sequences and let these mutated RNA molecules have another go at the reaction.

When a cell divides, the strands peel apart, and DNA polymerase builds matching strands one nucleotide at a time.

Furthermore, by adding guanine nucleotides at the end of sgRNA (single guided RNA) that composes CRISPR - Cas9, they have successfully created this highly - developed programmable nuclease, which has no measurable off - target effects in the human genome.

The 5386 nucleotides of fC became the first complete DNA to be sequenced (by Fred Sanger's laboratory in Cambridge in 1977) and Sinsheimer is justifiably proud at having put fC on the map.

Results from three Phase III clinical trials (ION - 1, ION - 2 and ION - 3) evaluating the investigational once - daily fixed - dose combination of the nucleotide analogue polymerase inhibitor sofosbuvir (SOF) 400 mg and the NS5A inhibitor ledipasvir (LDV) 90 mg, with and without ribavirin (RBV), for the treatment of genotype 1 chronic hepatitis C virus (HCV) infection have been presented at the International Liver CongressTM 2014.

Normally, mutations in genetic sequences that give rise to herbicide resistance happen at the scale of a single nucleotide.

The researchers looked at functional single nucleotide polymorphisms within the CLOCK gene that are able to influence how much protein is transcribed from the gene.

Since nucleotides are needed to build duplicate copies of a cell's DNA before it can divide, SAMHD1's activity is carefully regulated so that it is active only when the cell is at rest and not dividing.

They got a big surprise: Although Neandertals differ from modern humans at an average of 202 nucleotide positions in the mitochondrial genome, the Denisova hominin differed at an average of 385 positions from modern humans and 376 from Neandertals, the team reports online today in Nature.

Transcription start site — associated RNAs (TSSa - RNAs) nonrandomly flank active promoters, with peaks of antisense and sense short RNAs at 250 nucleotides upstream and 50 nucleotides downstream of TSSs, respectively.

A SNP is a variation of one nucleotide, or DNA «letter,» at a specified location in the genome.

From beetles collected at 27 sites in Alberta and British Columbia, they looked for any patterns amongst their catalog of 1536 mutations (single - nucleotide polymorphisms, or SNPs).

Telomeres are repetitive nucleotide sequences found at the end of chromosomes which protect them from deteriorating during the process of replication.

Scientists at King's College London have found that people who have previously suffered from acne are likely to have longer telomeres (the protective repeated nucleotides found at the end of chromosomes) in their white blood cells, meaning their cells could be better protected against aging.

Telomeres are stretches of protective, repetitive nucleotide sequences at the ends of chromosomes.

We have determined at 2.1 angstrom resolution the crystal structure of a T7 RNAP elongation complex with 30 base pairs of duplex DNA containing a «transcription bubble» interacting with a 17 - nucleotide RNA transcript.

«Ribonucleotides are the most abundant non-standard nucleotides that can be found in DNA, but until now there has not been a system to determine where they are located in the DNA, or to identify specifically which type they are,» said Francesca Storici, an associate professor in the School of Biology at the Georgia Institute of Technology.

Biochemist Nirenberg of the National Institutes of Health gave a seminar describing a groundbreaking experiment in which he and a colleague had discovered how the cell interprets messenger RNA — by reading one triplet, or codon, of nucleotide bases at a time — to line up the amino acids that form proteins.

Kole says antisense technology should also be better at restoring genetic function than knocking out oncogenes, which cause cancer, because oligo - nucleotides are often not 100 per cent effective.

The study used whole - exome sequencing to characterize genetic alterations that occur at the single nucleotide level for all genes in 25 cell lines commonly used as models of bladder cancer.