Sentences with phrase «coding sequence from»

Sequencing and BLAST analysis recealed a 87 — 91 % / 87 % nucleotide identity with a partial coding sequence from the Tembusu / Sitiawan virus E gene (encoding the envelope protein)(Fig. 7A).

cDNA libraries, which consist of plasmids that over-express coding sequences from a given cell type or organism, have been used in a similar manner to Cas9 activators.

Not exact matches

The drill hole intersected a thick repetitive sequence of mafic and felsic sediments which showed no major structural deformation, a potential host for gold mineralisation, with geochemical analysis revealing alteration and mineralisation based on micro analysis of the cores by world class scientists from CODES in Tasmania.

To test their hypothesis, the researchers used next - generation sequencing (NGS) technology to sequence the complete set of coding variants from the genomes of individuals from seven populations within and outside Africa, i.e. from the Democratic Republic of Congo, Namibia, Algeria, Pakistan, Cambodia, Siberia and Mexico.

These are sequences made in the lab from RNA — the template used to produce the proteins that genes code for.

The authors adapted a classical computer science algorithm to combine stable and distinguishing sequence features from individuals» initial microbiome samples into individual - specific «codes.»

To derive an evolutionary tree of the TRIM5 gene, they analyzed and compared its complete protein - coding DNA sequences from 22 African primate species.

Obtaining it from living humans is not difficult, but it's a formidable challenge to extract and sequence genome - wide aDNA, which can degrade into fragments, undergo chemical reactions that change its code, and be contaminated by modern DNA.

Bar coding typically involves sequencing a few short segments of animal DNA from the mitochondria, the mini-organs that produce energy within every cell.

Afterward, a technician from the main hospital in the Faroes squirted about 2 milligrams of blood into a special tube with buffers to purify and stabilize his DNA, so that it could be sent to a laboratory to sequence the 3 billion letters that make up the code of his genome.

With such long stretches of DNA, Hung and his team could assess the extent to which the sequences of DNA code in the genes in the three specimens varied from bird to bird.

By comparing proteomic and RNA - sequencing data from people on different exercise programs, the researchers found evidence that exercise encourages the cell to make more RNA copies of genes coding for mitochondrial proteins and proteins responsible for muscle growth.

The team integrated three, complementary gene sequencing approaches to look for mutations in tumor cells from SS patients: whole - genome sequencing in six subjects, sequencing of all protein - coding regions (exomes) in 66 subjects, and comparing variation in the number of copies of all genes across the genome in 80 subjects.

Many researchers now believe that real advances in genomics will come not from simple X-causes-Y correlations but from a rich statistical understanding that emerges out of the sequences of millions of genomes — a set that reveals how our genetic code is likely to interact with the environment to make us who we are.

The gene that codes for this clotting protein has a very similar sequence across many plant species, and the researchers showed that the microRNA from dodder targets regions of the gene sequence that are the most highly conserved across plants.

From these efforts, we identified a high - quality orthologous gene set across avian species, consisting of exons from 8251 syntenic protein - coding genes (~ 40 % of the proteome), introns from 2516 of these genes, and a nonoverlapping set of 3769 ultraconserved elements (UCEs) with ~ 1000 bp of flanking sequenFrom these efforts, we identified a high - quality orthologous gene set across avian species, consisting of exons from 8251 syntenic protein - coding genes (~ 40 % of the proteome), introns from 2516 of these genes, and a nonoverlapping set of 3769 ultraconserved elements (UCEs) with ~ 1000 bp of flanking sequenfrom 8251 syntenic protein - coding genes (~ 40 % of the proteome), introns from 2516 of these genes, and a nonoverlapping set of 3769 ultraconserved elements (UCEs) with ~ 1000 bp of flanking sequenfrom 2516 of these genes, and a nonoverlapping set of 3769 ultraconserved elements (UCEs) with ~ 1000 bp of flanking sequences.

These are sequences produced in the lab from the RNA that is the intermediate step between gene and the protein it codes for.

In brown bears, the sequence of this gene varies from one bear to another, but all the polar bears surveyed have an identical version, with the exact same genetic code at nine variable spots in the gene, about half of which should change the function of the APOB protein.

«This is the first time the complete genetic code — the genome — of any vertebrate species from Panama has been sequenced and analyzed,» said Oris Sanjur, co-author and Associate Director for Science Administration at STRI.

Sequencing devices take long strings of a person's DNA and randomly chop them into small pieces that can be individually analyzed to determine their sequence of letters from the genetic code (A, C, G and T representing the four key components of DNA that code for protein production in living organisms: adenine, cytosine, guanine and thymine).

There, with help from Wasser and his colleagues in Seattle, geneticist Al Roca sequenced introns — vestigial sections of DNA from the nucleus that accumulate mutations quickly because they don't code for any physical traits — and confirmed that forest and savanna elephants diverged at least 2.6 million and probably more than 3 million years ago — long enough to render them separate species.

The team also carried out a so - called metagenomic analysis, in which the genomes from all organisms in a sample are sequenced collectively; the great majority of genes they found coded for proteins never seen before.

The researchers learned that the astonishing diversity of cadherin in pink bollworm from India is caused by alternative splicing, a novel mechanism of resistance that allows a single DNA sequence to code for many variants of a protein.

The sequencing of the human genome (ScienceNOW, 14 April 2003:) gave scientists major new insights into what makes us human: Although we share more than 98 % of our genetic code with the chimpanzee, natural selection has turned us into a very different animal than the chimps, from whom our hominid ancestors split evolutionarily some 6 million years ago (ScienceNOW, 31 August).

The coding sequence of chicken Acvr1 was PCR amplified from chicken embryo cDNA using the following primer pair: chAcvr1 - NcoI - fwd, 5 ′ - ACCATGGCTCTCCCCGTGCTGCTG - 3 ′ and chAcvr1 - BamHI - rev, 5 ′ - AGGATCCTCAACAGTCAGCCTTCAGTTT - 3 ′.

A mile - stone has been achieved with data for 75 % of the human protein - coding genes and protein evidence for all human genes predicted from the genome sequence.

In addition, we analysed sequence data from sixty individuals representing six closely related species from Lake Victoria, and show genome - wide diversifying selection on coding and regulatory variants, some of which were recruited from ancient polymorphisms.

A DNA sequence that was derived originally from a functional protein - coding gene that has lost its function owing to the presence of one or more inactivating mutations.

By analyzing these two exomes together with the genome sequence of a Neandertal from Siberia we show that the genetic diversity of Neandertals was lower than that of present - day humans and that the pattern of coding variation suggests that Neandertal populations were small and isolated from one another.

The coding sequences of the genes most similar to the rice D11 gene and Arabidopsis Dwf4 gene were obtained from the Phytozome (phytozome.jgi.doe.gov) and Gramene (gramene.org) databases (Supplemental Data Set 2).

Contains a 2897 bp 5» Sacl 3» Xhol HXB2 env fragment from HXB2gpt (env coding sequences are nt 6224 - 8794).

The average tree topology inferred from the coding sequences of the whole exome is shown in Fig. 2A.

Jacob A. Tennessen et al., «Evolution and Functional Impact of Rare Coding Variations from Deep Sequencing of Human Exomes,» Science, Vol.

In order to know what parts of the code are used to regulate cell functions and create traits the RNA from the organism needs to be sequenced.

To reveal the structural genetic code, researchers examine chromatin from its sequence of nucleotides to the organisation of an entire genome.

In order for this sequence to become a gene coding a protein, at a minimum the first lowercase, dark orange codon needs to be mutated to ATG, a start codon, and the rest of the lowercase, dark orange codons need to be mutated away from being stop codons.

The DNA we can retrieve from passenger pigeon specimens is too fragmented to reassemble the entire genomic code — but we can map the sequence of genes and gene regulating regions that are most important to creating passenger pigeon traits.

The published P. coatneyi genome assembly14 (accession numbers CP016239 to CP016252 from NCBI) contains several large open reading frames that appear to correspond to coding sequences, especially in the subtelomeric regions.

The remaining cassette can invert as long as Cre remains expressed; once Cre is removed from the system, the fluorescent protein whose coding sequence is closest to the promoter will be expressed.

In June 2000, scientists from the Human Genome Project and from Celera Genomics both announced that they had assembled a working draft sequence of the human genome, a major step in cracking the code.

We used custom microarrays to capture and Illumina sequence 6 Mb of targeted intronic DNA, and combined this dataset with published protein coding sequences derived from transcriptome sequencing [28]--[29].

Coding exons, exon — intron junctions, and 5 ′ - and 3 ′ - UTRs of the psq gene were sequenced in genomic DNA from psqrum homozygous flies and from flies carrying the parental chromosome (FRTG13 c px sp; Luschnig et al. 2004).

Two adenovirus mRNAs have a common 5 ′ terminal leader sequence encoded at least 10 kb upstream from their main coding regions

We have gone from sequencing small fragments of DNA to full mitochondrial genomes (17,000 base pairs of genetic code), and then in the last three years the field exploded into the realm of complete nuclear genomes.

From the test sequence data, my colleagues and I knew that the specimens were «complex» enough to obtain the full genome, but the only way to put the code together would be by using the genome of the band - tailed pigeon as a reference map.

Using exome sequences from 3222 British - Pakistani individuals with high parental relatedness, we estimate a mutation rate of 1.45 ± 0.05 × 10 -LRB--8) per base pair per generation in autosomal coding sequence, with a corresponding non-crossover gene conversion rate of 8.75 ± 0.05 × 10 -LRB--6) per base pair per generation.

By performing a meta - analysis of rare coding variants in whole - exome sequences from 4,133 schizophrenia cases and 9,274 controls, de novo mutations in 1,077 family trios, and copy number variants from 6,882 cases and 11,255 controls, we show that individuals with schizophrenia carry a significant burden of rare, damaging variants in 3,488 genes previously identified as having a near - complete depletion of loss - of - function variants.

While whole genome sequencing studies have failed to identify coding mutations in 40 % of the cases, there is evidence from recent efforts to annotate the non-coding sequence that over 80 % of the genome is biochemically active.

We sequenced the protein - coding regions of 9,793 genomes from patients with MI at an early age (≤ 50 years in males and ≤ 60 years in females) along with MI - free controls.

Here we sequence the protein - coding regions of 10,503 adult participants in the Pakistan Risk of Myocardial Infarction Study (PROMIS), designed to understand the determinants of cardiometabolic diseases in individuals from South Asia.