Sentences with phrase «coding sequence of»

As reported in that study, there are two major splice variants for the coding sequence of zebra finch FoxP2.

The presence of such sequences could provide organisms with a way to modify their gene expression without altering the actual coding sequence of genes.

We examined the coding sequence of 518 protein kinases, approximately 1.3 Mb of DNA per sample, in 25 breast cancers.

We also found that 83 per cent of the cDNAs were reproduced perfectly in the RNA - Seq set at the level of the coding sequence of the transcript (the bit that actually codes for protein).

The following transgenic lines regulated by W01A8.1 natural promoter were prepared: W01A8.1 a / c:: gfp and W01A8.1 b:: gfp (containing the whole coding sequence of isoforms a and b).

The coding sequence of chicken Acvr1 was PCR amplified from chicken embryo cDNA using the following primer pair: chAcvr1 - NcoI - fwd, 5 ′ - ACCATGGCTCTCCCCGTGCTGCTG - 3 ′ and chAcvr1 - BamHI - rev, 5 ′ - AGGATCCTCAACAGTCAGCCTTCAGTTT - 3 ′.

All the plant groups the researchers examined, except liverworts, contained at least one of three distinct introns — useless chunks of DNA located inside the coding sequence of a gene — in two different genes.

To identify genetic changes likely to be responsible for the giraffe's unique characteristics, including sprints that can reach 37 miles per hour (60 km / h), Cavener and Agaba compared the gene - coding sequences of the giraffe and the okapi to more than forty other mammals including the cow, sheep, goat, camel, and human.

Using this «Ribotag» approach tissue - specific changes under DR have been measured in muscle, fat, gut, heart, neurons, germline and malpighian tubules, showing a highly tissue specific response upon DR.. We are developing mechanistic models of gene expression regulation and conducting comprehensive bioinformatics analyses on UTRs, promoters and the coding sequences of various elements of differentially regulated genes.

The coding sequences of the genes most similar to the rice D11 gene and Arabidopsis Dwf4 gene were obtained from the Phytozome (phytozome.jgi.doe.gov) and Gramene (gramene.org) databases (Supplemental Data Set 2).

We screened the coding sequences of 518 protein kinases (approximately 1.3 Mb of DNA per sample) for somatic mutations in 26 primary lung neoplasms and seven lung cancer cell lines.

The average tree topology inferred from the coding sequences of the whole exome is shown in Fig. 2A.

Biased gene conversion and GC - content evolution in the coding sequences of reptiles and vertebrates.

There are also many other differences in the number or coding sequences of ankyrin repeat genes between wMel strain genomes and wAu [21], [49](see also [15] and [48] for sequence of wMelCS).

In most cases the putative coding sequences of OR and V1R genes span a single exon and the additional exons contains only UTRs.

Not exact matches

That's not to say gene editing is new (it isn't), but Crispr simplifies the process by using molecular scissors that can be precisely targeted to snip out aberrant regions of genetic code, which can then be replaced with the correct sequences.

The initial New York suit alleges that after Bounce Exchange provided Yieldify execs with a product demonstration in 2013, they «copied hundreds of lines of code and generally replicated the overall structure, sequence, and organization of the Bounce Exchange Software.»

It would «be impossible in practise [sic] for MS to revoke every bootmgr» — the code that guides the earliest stages of a computer's startup sequence — Slipstream wrote, «as they'd break install media, recovery partitions, backups, etc..»

If you want to read more about it, Peter Kafka at Re / code and Farhad Manjoo at the New York Times have both looked at the sequence of events that led to Gigaom's demise.

DNA, made up of four nucleotide molecules in a sequence, is a code that can be edited and written — not unlike software.

The commercialization of DNA sequencing (the reading of an organism's code) and synthesis (the writing of that code) has accelerated since the mapping of the human genome was completed in 2003.

The drill hole intersected a thick repetitive sequence of mafic and felsic sediments which showed no major structural deformation, a potential host for gold mineralisation, with geochemical analysis revealing alteration and mineralisation based on micro analysis of the cores by world class scientists from CODES in Tasmania.

The sequence of hacks specified in the study are the following; innovate (aid) money with cryptocurrency, turn rights into code on the blockchain, program aid money and agreements, and disrupt the aid model in general.

Does this sequence of letters contain a hidden code, or is it just a random string.

But as I understand it, even mutations and non functioning genetic sequences can become part of the genetic code and be passed down.

The laws of physics and chemistry hold, as reductivists rightly insist, universally; they are entirely unaffected by the particular linear sequence that characterizes the triplet code.

Science in the usual sense does not deal adequately with the factor of coded sequence; it does not often even advert to it, though the use of computer models is beginning to enhance our understanding of the many possible patterns of information at every level of matter and life.

Digital communication works by discerning and converting all information into discreet sequences of on - off pulses, corresponding with the 0 and 1 binary code used by computers.

Is it not legitimate to go beyond the chemical factors involved and to ask what factors may be involved in determining the specific sequence in the code of life?

Can we rule out the presence of some sort of «extraneous» causation operating somehow at the level of DNA's sequence, communicating «information» through the instability of the code, writing its meaning into the cosmos?

The meaning of this chapter has been made «incarnate» by the author in a specific sequence of letters of a code whose variability has allowed him to arrange them in the pattern you see before you.

I believe that no one does the math — the logic of math is in favour of creation over evolution — «random chance» aka evolution is mathematically to astounding to believe — Alfred Hoyles number don't lie... and dna is a code — random chance can not create a code sequence nor can random chance ever improve itself... just think about it — mathmatically speaking there is a god or creator or creators of the code for life.

biochemical evidence such as Cytochrome - cyto - C is just one of the thousands of sequences and is not proof of common ancestry, as there are more variations than similarities in the genetic code, on the other hand a study of the amino acid make - up reveals that man is closer to lamprey than are fish.

This measurement of relatedness is strong evidence of shared descent, especially because many of the DNA sequences are junk that codes for nothing, but are still shared because of common descent.

The point being that nobody knows how different the intron or non-protein coding sequences are between humans and other primates because the research quoted is only on the exons, or protein coding portions of the genome.

The researches found that the transgene was inserted into an active region of the genome, thereby disrupting the coding sequence and ultimately the function of the plants own OsAux1 gene.

For example, we added in a sequence of colour changes for Milo and some sounds, much to the amusement of my children you can even record yourself talking, or making noises and add those to the code too.

The sequence of «monthly» Code Action Reports, posted to Nestlé's anti-boycott website (link now dead as these are too embarrassing for Nestlé), are as follows:

The major function of DNA is to encode the sequence of amino acid residues in proteins, using the genetic code.

Affordable genetic sequencing and a new database of «DNA bar codes» help combat the practice of selling one fish as another

To test their hypothesis, the researchers used next - generation sequencing (NGS) technology to sequence the complete set of coding variants from the genomes of individuals from seven populations within and outside Africa, i.e. from the Democratic Republic of Congo, Namibia, Algeria, Pakistan, Cambodia, Siberia and Mexico.

When the human genome draft was announced 10 years ago, many researchers and policymakers anticipated using the newly sequenced code to develop a wealth of diagnostic and treatment capabilities.

Now scientists think they have cracked the code: Insect nerve cells appear to fire in a sequence unique to each smell, says a report in the 14 November issue of Nature.

The open reading frame of the sequenced clone coded for 97 amino acids, including the known amino acid sequence of this polypeptide.

He identified a short stretch of its sequence that repeatedly coded for leucine, an amino acid.

Gene discovery was greatly facilitated by a new exome sequencing technology, which analyzes all protein - coding regions of the genome at once.

To derive an evolutionary tree of the TRIM5 gene, they analyzed and compared its complete protein - coding DNA sequences from 22 African primate species.

The Genographic Project: Testing My Maternal Ancestry Commercial testing companies do not need to test my whole genetic sequence — all 3 billion nucleotides, the «letters» of the genetic code — to tap into my past.

Bar coding typically involves sequencing a few short segments of animal DNA from the mitochondria, the mini-organs that produce energy within every cell.

The team sequenced the gene that codes for the NaV1.7 channel in mole rats, and compared it with SCN9A — a key gene in the human version of the channel.