In case the Master Policyholder / Scheme Member is not agreeable to any policy terms and
conditions under this product, the Master Policyholder / Scheme Member shall have the option of returning the Policy / Certificate of insurance to us stating the reasons thereof, within 15 days from the date of receipt of the Policy / Certificate of insurance, as per IRDA (Protection of Policyholders» Interests) Regulations, 2017.
In case the policyholder is not agreeable to any policy terms and
conditions under this product, the policyholder shall have the option of returning the policy to us stating the reasons thereof, within 15 days from the date of receipt of the policy, as per IRDA (Protection of Policyholders» Interests) Regulations, 2017.
Not exact matches
Important factors that could cause actual results to differ materially from those reflected in such forward - looking statements and that should be considered in evaluating our outlook include, but are not limited to, the following: 1) our ability to continue to grow our business and execute our growth strategy, including the timing, execution, and profitability of new and maturing programs; 2) our ability to perform our obligations
under our new and maturing commercial, business aircraft, and military development programs, and the related recurring production; 3) our ability to accurately estimate and manage performance, cost, and revenue
under our contracts, including our ability to achieve certain cost reductions with respect to the B787 program; 4) margin pressures and the potential for additional forward losses on new and maturing programs; 5) our ability to accommodate, and the cost of accommodating, announced increases in the build rates of certain aircraft; 6) the effect on aircraft demand and build rates of changing customer preferences for business aircraft, including the effect of global economic
conditions on the business aircraft market and expanding conflicts or political unrest in the Middle East or Asia; 7) customer cancellations or deferrals as a result of global economic uncertainty or otherwise; 8) the effect of economic
conditions in the industries and markets in which we operate in the U.S. and globally and any changes therein, including fluctuations in foreign currency exchange rates; 9) the success and timely execution of key milestones such as the receipt of necessary regulatory approvals, including our ability to obtain in a timely fashion any required regulatory or other third party approvals for the consummation of our announced acquisition of Asco, and customer adherence to their announced schedules; 10) our ability to successfully negotiate, or re-negotiate, future pricing
under our supply agreements with Boeing and our other customers; 11) our ability to enter into profitable supply arrangements with additional customers; 12) the ability of all parties to satisfy their performance requirements
under existing supply contracts with our two major customers, Boeing and Airbus, and other customers, and the risk of nonpayment by such customers; 13) any adverse impact on Boeing's and Airbus» production of aircraft resulting from cancellations, deferrals, or reduced orders by their customers or from labor disputes, domestic or international hostilities, or acts of terrorism; 14) any adverse impact on the demand for air travel or our operations from the outbreak of diseases or epidemic or pandemic outbreaks; 15) our ability to avoid or recover from cyber-based or other security attacks, information technology failures, or other disruptions; 16) returns on pension plan assets and the impact of future discount rate changes on pension obligations; 17) our ability to borrow additional funds or refinance debt, including our ability to obtain the debt to finance the purchase price for our announced acquisition of Asco on favorable terms or at all; 18) competition from commercial aerospace original equipment manufacturers and other aerostructures suppliers; 19) the effect of governmental laws, such as U.S. export control laws and U.S. and foreign anti-bribery laws such as the Foreign Corrupt Practices Act and the United Kingdom Bribery Act, and environmental laws and agency regulations, both in the U.S. and abroad; 20) the effect of changes in tax law, such as the effect of The Tax Cuts and Jobs Act (the «TCJA») that was enacted on December 22, 2017, and changes to the interpretations of or guidance related thereto, and the Company's ability to accurately calculate and estimate the effect of such changes; 21) any reduction in our credit ratings; 22) our dependence on our suppliers, as well as the cost and availability of raw materials and purchased components; 23) our ability to recruit and retain a critical mass of highly - skilled employees and our relationships with the unions representing many of our employees; 24) spending by the U.S. and other governments on defense; 25) the possibility that our cash flows and our credit facility may not be adequate for our additional capital needs or for payment of interest on, and principal of, our indebtedness; 26) our exposure
under our revolving credit facility to higher interest payments should interest rates increase substantially; 27) the effectiveness of any interest rate hedging programs; 28) the effectiveness of our internal control over financial reporting; 29) the outcome or impact of ongoing or future litigation, claims, and regulatory actions; 30) exposure to potential
product liability and warranty claims; 31) our ability to effectively assess, manage and integrate acquisitions that we pursue, including our ability to successfully integrate the Asco business and generate synergies and other cost savings; 32) our ability to consummate our announced acquisition of Asco in a timely matter while avoiding any unexpected costs, charges, expenses, adverse changes to business relationships and other business disruptions for ourselves and Asco as a result of the acquisition; 33) our ability to continue selling certain receivables through our supplier financing program; 34) the risks of doing business internationally, including fluctuations in foreign current exchange rates, impositions of tariffs or embargoes, compliance with foreign laws, and domestic and foreign government policies; and 35) our ability to complete the proposed accelerated stock repurchase plan, among other things.
Aaron Lamstein was totally up - front about the fact that he can't vouch for every
condition under which workers manufacture his
products, since the factories he uses are spread out across the United States, nor can he claim that all the components that accompany WorldWise's goods are recycled or organic.
Actual results, including with respect to our targets and prospects, could differ materially due to a number of factors, including the risk that we may not obtain sufficient orders to achieve our targeted revenues; price competition in key markets; the risk that we or our channel partners are not able to develop and expand customer bases and accurately anticipate demand from end customers, which can result in increased inventory and reduced orders as we experience wide fluctuations in supply and demand; the risk that our commercial Lighting
Products results will continue to suffer if new issues arise regarding issues related to product quality for this business; the risk that we may experience production difficulties that preclude us from shipping sufficient quantities to meet customer orders or that result in higher production costs and lower margins; our ability to lower costs; the risk that our results will suffer if we are unable to balance fluctuations in customer demand and capacity, including bringing on additional capacity on a timely basis to meet customer demand; the risk that longer manufacturing lead times may cause customers to fulfill their orders with a competitor's products instead; the risk that the economic and political uncertainty caused by the proposed tariffs by the United States on Chinese goods, and any corresponding Chinese tariffs in response, may negatively impact demand for our products; product mix; risks associated with the ramp - up of production of our new products, and our entry into new business channels different from those in which we have historically operated; the risk that customers do not maintain their favorable perception of our brand and products, resulting in lower demand for our products; the risk that our products fail to perform or fail to meet customer requirements or expectations, resulting in significant additional costs, including costs associated with warranty returns or the potential recall of our products; ongoing uncertainty in global economic conditions, infrastructure development or customer demand that could negatively affect product demand, collectability of receivables and other related matters as consumers and businesses may defer purchases or payments, or default on payments; risks resulting from the concentration of our business among few customers, including the risk that customers may reduce or cancel orders or fail to honor purchase commitments; the risk that we are not able to enter into acceptable contractual arrangements with the significant customers of the acquired Infineon RF Power business or otherwise not fully realize anticipated benefits of the transaction; the risk that retail customers may alter promotional pricing, increase promotion of a competitor's products over our products or reduce their inventory levels, all of which could negatively affect product demand; the risk that our investments may experience periods of significant stock price volatility causing us to recognize fair value losses on our investment; the risk posed by managing an increasingly complex supply chain that has the ability to supply a sufficient quantity of raw materials, subsystems and finished products with the required specifications and quality; the risk we may be required to record a significant charge to earnings if our goodwill or amortizable assets become impaired; risks relating to confidential information theft or misuse, including through cyber-attacks or cyber intrusion; our ability to complete development and commercialization of products under development, such as our pipeline of Wolfspeed products, improved LED chips, LED components, and LED lighting products risks related to our multi-year warranty periods for LED lighting products; risks associated with acquisitions, divestitures, joint ventures or investments generally; the rapid development of new technology and competing products that may impair demand or render our products obsolete; the potential lack of customer acceptance for our products; risks associated with ongoing litigation; and other factors discussed in our filings with the Securities and Exchange Commission (SEC), including our report on Form 10 - K for the fiscal year ended June 25, 2017, and subsequent reports filed with
Products results will continue to suffer if new issues arise regarding issues related to
product quality for this business; the risk that we may experience production difficulties that preclude us from shipping sufficient quantities to meet customer orders or that result in higher production costs and lower margins; our ability to lower costs; the risk that our results will suffer if we are unable to balance fluctuations in customer demand and capacity, including bringing on additional capacity on a timely basis to meet customer demand; the risk that longer manufacturing lead times may cause customers to fulfill their orders with a competitor's
products instead; the risk that the economic and political uncertainty caused by the proposed tariffs by the United States on Chinese goods, and any corresponding Chinese tariffs in response, may negatively impact demand for our products; product mix; risks associated with the ramp - up of production of our new products, and our entry into new business channels different from those in which we have historically operated; the risk that customers do not maintain their favorable perception of our brand and products, resulting in lower demand for our products; the risk that our products fail to perform or fail to meet customer requirements or expectations, resulting in significant additional costs, including costs associated with warranty returns or the potential recall of our products; ongoing uncertainty in global economic conditions, infrastructure development or customer demand that could negatively affect product demand, collectability of receivables and other related matters as consumers and businesses may defer purchases or payments, or default on payments; risks resulting from the concentration of our business among few customers, including the risk that customers may reduce or cancel orders or fail to honor purchase commitments; the risk that we are not able to enter into acceptable contractual arrangements with the significant customers of the acquired Infineon RF Power business or otherwise not fully realize anticipated benefits of the transaction; the risk that retail customers may alter promotional pricing, increase promotion of a competitor's products over our products or reduce their inventory levels, all of which could negatively affect product demand; the risk that our investments may experience periods of significant stock price volatility causing us to recognize fair value losses on our investment; the risk posed by managing an increasingly complex supply chain that has the ability to supply a sufficient quantity of raw materials, subsystems and finished products with the required specifications and quality; the risk we may be required to record a significant charge to earnings if our goodwill or amortizable assets become impaired; risks relating to confidential information theft or misuse, including through cyber-attacks or cyber intrusion; our ability to complete development and commercialization of products under development, such as our pipeline of Wolfspeed products, improved LED chips, LED components, and LED lighting products risks related to our multi-year warranty periods for LED lighting products; risks associated with acquisitions, divestitures, joint ventures or investments generally; the rapid development of new technology and competing products that may impair demand or render our products obsolete; the potential lack of customer acceptance for our products; risks associated with ongoing litigation; and other factors discussed in our filings with the Securities and Exchange Commission (SEC), including our report on Form 10 - K for the fiscal year ended June 25, 2017, and subsequent reports filed with
products instead; the risk that the economic and political uncertainty caused by the proposed tariffs by the United States on Chinese goods, and any corresponding Chinese tariffs in response, may negatively impact demand for our
products; product mix; risks associated with the ramp - up of production of our new products, and our entry into new business channels different from those in which we have historically operated; the risk that customers do not maintain their favorable perception of our brand and products, resulting in lower demand for our products; the risk that our products fail to perform or fail to meet customer requirements or expectations, resulting in significant additional costs, including costs associated with warranty returns or the potential recall of our products; ongoing uncertainty in global economic conditions, infrastructure development or customer demand that could negatively affect product demand, collectability of receivables and other related matters as consumers and businesses may defer purchases or payments, or default on payments; risks resulting from the concentration of our business among few customers, including the risk that customers may reduce or cancel orders or fail to honor purchase commitments; the risk that we are not able to enter into acceptable contractual arrangements with the significant customers of the acquired Infineon RF Power business or otherwise not fully realize anticipated benefits of the transaction; the risk that retail customers may alter promotional pricing, increase promotion of a competitor's products over our products or reduce their inventory levels, all of which could negatively affect product demand; the risk that our investments may experience periods of significant stock price volatility causing us to recognize fair value losses on our investment; the risk posed by managing an increasingly complex supply chain that has the ability to supply a sufficient quantity of raw materials, subsystems and finished products with the required specifications and quality; the risk we may be required to record a significant charge to earnings if our goodwill or amortizable assets become impaired; risks relating to confidential information theft or misuse, including through cyber-attacks or cyber intrusion; our ability to complete development and commercialization of products under development, such as our pipeline of Wolfspeed products, improved LED chips, LED components, and LED lighting products risks related to our multi-year warranty periods for LED lighting products; risks associated with acquisitions, divestitures, joint ventures or investments generally; the rapid development of new technology and competing products that may impair demand or render our products obsolete; the potential lack of customer acceptance for our products; risks associated with ongoing litigation; and other factors discussed in our filings with the Securities and Exchange Commission (SEC), including our report on Form 10 - K for the fiscal year ended June 25, 2017, and subsequent reports filed with
products;
product mix; risks associated with the ramp - up of production of our new
products, and our entry into new business channels different from those in which we have historically operated; the risk that customers do not maintain their favorable perception of our brand and products, resulting in lower demand for our products; the risk that our products fail to perform or fail to meet customer requirements or expectations, resulting in significant additional costs, including costs associated with warranty returns or the potential recall of our products; ongoing uncertainty in global economic conditions, infrastructure development or customer demand that could negatively affect product demand, collectability of receivables and other related matters as consumers and businesses may defer purchases or payments, or default on payments; risks resulting from the concentration of our business among few customers, including the risk that customers may reduce or cancel orders or fail to honor purchase commitments; the risk that we are not able to enter into acceptable contractual arrangements with the significant customers of the acquired Infineon RF Power business or otherwise not fully realize anticipated benefits of the transaction; the risk that retail customers may alter promotional pricing, increase promotion of a competitor's products over our products or reduce their inventory levels, all of which could negatively affect product demand; the risk that our investments may experience periods of significant stock price volatility causing us to recognize fair value losses on our investment; the risk posed by managing an increasingly complex supply chain that has the ability to supply a sufficient quantity of raw materials, subsystems and finished products with the required specifications and quality; the risk we may be required to record a significant charge to earnings if our goodwill or amortizable assets become impaired; risks relating to confidential information theft or misuse, including through cyber-attacks or cyber intrusion; our ability to complete development and commercialization of products under development, such as our pipeline of Wolfspeed products, improved LED chips, LED components, and LED lighting products risks related to our multi-year warranty periods for LED lighting products; risks associated with acquisitions, divestitures, joint ventures or investments generally; the rapid development of new technology and competing products that may impair demand or render our products obsolete; the potential lack of customer acceptance for our products; risks associated with ongoing litigation; and other factors discussed in our filings with the Securities and Exchange Commission (SEC), including our report on Form 10 - K for the fiscal year ended June 25, 2017, and subsequent reports filed with
products, and our entry into new business channels different from those in which we have historically operated; the risk that customers do not maintain their favorable perception of our brand and
products, resulting in lower demand for our products; the risk that our products fail to perform or fail to meet customer requirements or expectations, resulting in significant additional costs, including costs associated with warranty returns or the potential recall of our products; ongoing uncertainty in global economic conditions, infrastructure development or customer demand that could negatively affect product demand, collectability of receivables and other related matters as consumers and businesses may defer purchases or payments, or default on payments; risks resulting from the concentration of our business among few customers, including the risk that customers may reduce or cancel orders or fail to honor purchase commitments; the risk that we are not able to enter into acceptable contractual arrangements with the significant customers of the acquired Infineon RF Power business or otherwise not fully realize anticipated benefits of the transaction; the risk that retail customers may alter promotional pricing, increase promotion of a competitor's products over our products or reduce their inventory levels, all of which could negatively affect product demand; the risk that our investments may experience periods of significant stock price volatility causing us to recognize fair value losses on our investment; the risk posed by managing an increasingly complex supply chain that has the ability to supply a sufficient quantity of raw materials, subsystems and finished products with the required specifications and quality; the risk we may be required to record a significant charge to earnings if our goodwill or amortizable assets become impaired; risks relating to confidential information theft or misuse, including through cyber-attacks or cyber intrusion; our ability to complete development and commercialization of products under development, such as our pipeline of Wolfspeed products, improved LED chips, LED components, and LED lighting products risks related to our multi-year warranty periods for LED lighting products; risks associated with acquisitions, divestitures, joint ventures or investments generally; the rapid development of new technology and competing products that may impair demand or render our products obsolete; the potential lack of customer acceptance for our products; risks associated with ongoing litigation; and other factors discussed in our filings with the Securities and Exchange Commission (SEC), including our report on Form 10 - K for the fiscal year ended June 25, 2017, and subsequent reports filed with
products, resulting in lower demand for our
products; the risk that our products fail to perform or fail to meet customer requirements or expectations, resulting in significant additional costs, including costs associated with warranty returns or the potential recall of our products; ongoing uncertainty in global economic conditions, infrastructure development or customer demand that could negatively affect product demand, collectability of receivables and other related matters as consumers and businesses may defer purchases or payments, or default on payments; risks resulting from the concentration of our business among few customers, including the risk that customers may reduce or cancel orders or fail to honor purchase commitments; the risk that we are not able to enter into acceptable contractual arrangements with the significant customers of the acquired Infineon RF Power business or otherwise not fully realize anticipated benefits of the transaction; the risk that retail customers may alter promotional pricing, increase promotion of a competitor's products over our products or reduce their inventory levels, all of which could negatively affect product demand; the risk that our investments may experience periods of significant stock price volatility causing us to recognize fair value losses on our investment; the risk posed by managing an increasingly complex supply chain that has the ability to supply a sufficient quantity of raw materials, subsystems and finished products with the required specifications and quality; the risk we may be required to record a significant charge to earnings if our goodwill or amortizable assets become impaired; risks relating to confidential information theft or misuse, including through cyber-attacks or cyber intrusion; our ability to complete development and commercialization of products under development, such as our pipeline of Wolfspeed products, improved LED chips, LED components, and LED lighting products risks related to our multi-year warranty periods for LED lighting products; risks associated with acquisitions, divestitures, joint ventures or investments generally; the rapid development of new technology and competing products that may impair demand or render our products obsolete; the potential lack of customer acceptance for our products; risks associated with ongoing litigation; and other factors discussed in our filings with the Securities and Exchange Commission (SEC), including our report on Form 10 - K for the fiscal year ended June 25, 2017, and subsequent reports filed with
products; the risk that our
products fail to perform or fail to meet customer requirements or expectations, resulting in significant additional costs, including costs associated with warranty returns or the potential recall of our products; ongoing uncertainty in global economic conditions, infrastructure development or customer demand that could negatively affect product demand, collectability of receivables and other related matters as consumers and businesses may defer purchases or payments, or default on payments; risks resulting from the concentration of our business among few customers, including the risk that customers may reduce or cancel orders or fail to honor purchase commitments; the risk that we are not able to enter into acceptable contractual arrangements with the significant customers of the acquired Infineon RF Power business or otherwise not fully realize anticipated benefits of the transaction; the risk that retail customers may alter promotional pricing, increase promotion of a competitor's products over our products or reduce their inventory levels, all of which could negatively affect product demand; the risk that our investments may experience periods of significant stock price volatility causing us to recognize fair value losses on our investment; the risk posed by managing an increasingly complex supply chain that has the ability to supply a sufficient quantity of raw materials, subsystems and finished products with the required specifications and quality; the risk we may be required to record a significant charge to earnings if our goodwill or amortizable assets become impaired; risks relating to confidential information theft or misuse, including through cyber-attacks or cyber intrusion; our ability to complete development and commercialization of products under development, such as our pipeline of Wolfspeed products, improved LED chips, LED components, and LED lighting products risks related to our multi-year warranty periods for LED lighting products; risks associated with acquisitions, divestitures, joint ventures or investments generally; the rapid development of new technology and competing products that may impair demand or render our products obsolete; the potential lack of customer acceptance for our products; risks associated with ongoing litigation; and other factors discussed in our filings with the Securities and Exchange Commission (SEC), including our report on Form 10 - K for the fiscal year ended June 25, 2017, and subsequent reports filed with
products fail to perform or fail to meet customer requirements or expectations, resulting in significant additional costs, including costs associated with warranty returns or the potential recall of our
products; ongoing uncertainty in global economic conditions, infrastructure development or customer demand that could negatively affect product demand, collectability of receivables and other related matters as consumers and businesses may defer purchases or payments, or default on payments; risks resulting from the concentration of our business among few customers, including the risk that customers may reduce or cancel orders or fail to honor purchase commitments; the risk that we are not able to enter into acceptable contractual arrangements with the significant customers of the acquired Infineon RF Power business or otherwise not fully realize anticipated benefits of the transaction; the risk that retail customers may alter promotional pricing, increase promotion of a competitor's products over our products or reduce their inventory levels, all of which could negatively affect product demand; the risk that our investments may experience periods of significant stock price volatility causing us to recognize fair value losses on our investment; the risk posed by managing an increasingly complex supply chain that has the ability to supply a sufficient quantity of raw materials, subsystems and finished products with the required specifications and quality; the risk we may be required to record a significant charge to earnings if our goodwill or amortizable assets become impaired; risks relating to confidential information theft or misuse, including through cyber-attacks or cyber intrusion; our ability to complete development and commercialization of products under development, such as our pipeline of Wolfspeed products, improved LED chips, LED components, and LED lighting products risks related to our multi-year warranty periods for LED lighting products; risks associated with acquisitions, divestitures, joint ventures or investments generally; the rapid development of new technology and competing products that may impair demand or render our products obsolete; the potential lack of customer acceptance for our products; risks associated with ongoing litigation; and other factors discussed in our filings with the Securities and Exchange Commission (SEC), including our report on Form 10 - K for the fiscal year ended June 25, 2017, and subsequent reports filed with
products; ongoing uncertainty in global economic
conditions, infrastructure development or customer demand that could negatively affect
product demand, collectability of receivables and other related matters as consumers and businesses may defer purchases or payments, or default on payments; risks resulting from the concentration of our business among few customers, including the risk that customers may reduce or cancel orders or fail to honor purchase commitments; the risk that we are not able to enter into acceptable contractual arrangements with the significant customers of the acquired Infineon RF Power business or otherwise not fully realize anticipated benefits of the transaction; the risk that retail customers may alter promotional pricing, increase promotion of a competitor's
products over our products or reduce their inventory levels, all of which could negatively affect product demand; the risk that our investments may experience periods of significant stock price volatility causing us to recognize fair value losses on our investment; the risk posed by managing an increasingly complex supply chain that has the ability to supply a sufficient quantity of raw materials, subsystems and finished products with the required specifications and quality; the risk we may be required to record a significant charge to earnings if our goodwill or amortizable assets become impaired; risks relating to confidential information theft or misuse, including through cyber-attacks or cyber intrusion; our ability to complete development and commercialization of products under development, such as our pipeline of Wolfspeed products, improved LED chips, LED components, and LED lighting products risks related to our multi-year warranty periods for LED lighting products; risks associated with acquisitions, divestitures, joint ventures or investments generally; the rapid development of new technology and competing products that may impair demand or render our products obsolete; the potential lack of customer acceptance for our products; risks associated with ongoing litigation; and other factors discussed in our filings with the Securities and Exchange Commission (SEC), including our report on Form 10 - K for the fiscal year ended June 25, 2017, and subsequent reports filed with
products over our
products or reduce their inventory levels, all of which could negatively affect product demand; the risk that our investments may experience periods of significant stock price volatility causing us to recognize fair value losses on our investment; the risk posed by managing an increasingly complex supply chain that has the ability to supply a sufficient quantity of raw materials, subsystems and finished products with the required specifications and quality; the risk we may be required to record a significant charge to earnings if our goodwill or amortizable assets become impaired; risks relating to confidential information theft or misuse, including through cyber-attacks or cyber intrusion; our ability to complete development and commercialization of products under development, such as our pipeline of Wolfspeed products, improved LED chips, LED components, and LED lighting products risks related to our multi-year warranty periods for LED lighting products; risks associated with acquisitions, divestitures, joint ventures or investments generally; the rapid development of new technology and competing products that may impair demand or render our products obsolete; the potential lack of customer acceptance for our products; risks associated with ongoing litigation; and other factors discussed in our filings with the Securities and Exchange Commission (SEC), including our report on Form 10 - K for the fiscal year ended June 25, 2017, and subsequent reports filed with
products or reduce their inventory levels, all of which could negatively affect
product demand; the risk that our investments may experience periods of significant stock price volatility causing us to recognize fair value losses on our investment; the risk posed by managing an increasingly complex supply chain that has the ability to supply a sufficient quantity of raw materials, subsystems and finished
products with the required specifications and quality; the risk we may be required to record a significant charge to earnings if our goodwill or amortizable assets become impaired; risks relating to confidential information theft or misuse, including through cyber-attacks or cyber intrusion; our ability to complete development and commercialization of products under development, such as our pipeline of Wolfspeed products, improved LED chips, LED components, and LED lighting products risks related to our multi-year warranty periods for LED lighting products; risks associated with acquisitions, divestitures, joint ventures or investments generally; the rapid development of new technology and competing products that may impair demand or render our products obsolete; the potential lack of customer acceptance for our products; risks associated with ongoing litigation; and other factors discussed in our filings with the Securities and Exchange Commission (SEC), including our report on Form 10 - K for the fiscal year ended June 25, 2017, and subsequent reports filed with
products with the required specifications and quality; the risk we may be required to record a significant charge to earnings if our goodwill or amortizable assets become impaired; risks relating to confidential information theft or misuse, including through cyber-attacks or cyber intrusion; our ability to complete development and commercialization of
products under development, such as our pipeline of Wolfspeed products, improved LED chips, LED components, and LED lighting products risks related to our multi-year warranty periods for LED lighting products; risks associated with acquisitions, divestitures, joint ventures or investments generally; the rapid development of new technology and competing products that may impair demand or render our products obsolete; the potential lack of customer acceptance for our products; risks associated with ongoing litigation; and other factors discussed in our filings with the Securities and Exchange Commission (SEC), including our report on Form 10 - K for the fiscal year ended June 25, 2017, and subsequent reports filed with
products under development, such as our pipeline of Wolfspeed
products, improved LED chips, LED components, and LED lighting products risks related to our multi-year warranty periods for LED lighting products; risks associated with acquisitions, divestitures, joint ventures or investments generally; the rapid development of new technology and competing products that may impair demand or render our products obsolete; the potential lack of customer acceptance for our products; risks associated with ongoing litigation; and other factors discussed in our filings with the Securities and Exchange Commission (SEC), including our report on Form 10 - K for the fiscal year ended June 25, 2017, and subsequent reports filed with
products, improved LED chips, LED components, and LED lighting
products risks related to our multi-year warranty periods for LED lighting products; risks associated with acquisitions, divestitures, joint ventures or investments generally; the rapid development of new technology and competing products that may impair demand or render our products obsolete; the potential lack of customer acceptance for our products; risks associated with ongoing litigation; and other factors discussed in our filings with the Securities and Exchange Commission (SEC), including our report on Form 10 - K for the fiscal year ended June 25, 2017, and subsequent reports filed with
products risks related to our multi-year warranty periods for LED lighting
products; risks associated with acquisitions, divestitures, joint ventures or investments generally; the rapid development of new technology and competing products that may impair demand or render our products obsolete; the potential lack of customer acceptance for our products; risks associated with ongoing litigation; and other factors discussed in our filings with the Securities and Exchange Commission (SEC), including our report on Form 10 - K for the fiscal year ended June 25, 2017, and subsequent reports filed with
products; risks associated with acquisitions, divestitures, joint ventures or investments generally; the rapid development of new technology and competing
products that may impair demand or render our products obsolete; the potential lack of customer acceptance for our products; risks associated with ongoing litigation; and other factors discussed in our filings with the Securities and Exchange Commission (SEC), including our report on Form 10 - K for the fiscal year ended June 25, 2017, and subsequent reports filed with
products that may impair demand or render our
products obsolete; the potential lack of customer acceptance for our products; risks associated with ongoing litigation; and other factors discussed in our filings with the Securities and Exchange Commission (SEC), including our report on Form 10 - K for the fiscal year ended June 25, 2017, and subsequent reports filed with
products obsolete; the potential lack of customer acceptance for our
products; risks associated with ongoing litigation; and other factors discussed in our filings with the Securities and Exchange Commission (SEC), including our report on Form 10 - K for the fiscal year ended June 25, 2017, and subsequent reports filed with
products; risks associated with ongoing litigation; and other factors discussed in our filings with the Securities and Exchange Commission (SEC), including our report on Form 10 - K for the fiscal year ended June 25, 2017, and subsequent reports filed with the SEC.
Among the factors that could cause actual results to differ materially are the following: (1) worldwide economic, political, and capital markets
conditions and other factors beyond the Company's control, including natural and other disasters or climate change affecting the operations of the Company or its customers and suppliers; (2) the Company's credit ratings and its cost of capital; (3) competitive
conditions and customer preferences; (4) foreign currency exchange rates and fluctuations in those rates; (5) the timing and market acceptance of new
product offerings; (6) the availability and cost of purchased components, compounds, raw materials and energy (including oil and natural gas and their derivatives) due to shortages, increased demand or supply interruptions (including those caused by natural and other disasters and other events); (7) the impact of acquisitions, strategic alliances, divestitures, and other unusual events resulting from portfolio management actions and other evolving business strategies, and possible organizational restructuring; (8) generating fewer productivity improvements than estimated; (9) unanticipated problems or delays with the phased implementation of a global enterprise resource planning (ERP) system, or security breaches and other disruptions to the Company's information technology infrastructure; (10) financial market risks that may affect the Company's funding obligations
under defined benefit pension and postretirement plans; and (11) legal proceedings, including significant developments that could occur in the legal and regulatory proceedings described in the Company's Annual Report on Form 10 - K for the year ended Dec. 31, 2017, and any subsequent quarterly reports on Form 10 - Q (the «Reports»).
As with diet supplements, a
product must meet the claim all the time; if they don't, it must be stated
under which
conditions these types of
products should be used.
This Terms of Use Agreement (the «Terms of Use») states the terms and
conditions under which you may use this website and all
products, services, content, tools, and information available through the website (referred to collectively as the «Site»).
We caution you that these statements are not guarantees of future performance and are subject to numerous risks and uncertainties, including volatility in the economy and the credit markets, supply and demand changes for vacation ownership and residential
products, competitive
conditions; the availability of capital to finance growth, and other matters referred to
under the heading «Risk Factors» contained in our Annual Report on 10 - K for the year ended December 30, 2011 filed with the U.S. Securities and Exchange Commission (the «SEC») and in subsequent SEC filings, any of which could cause actual results to differ materially from those expressed in or implied in this presentation.
We caution you that these statements are not guarantees of future performance and are subject to numerous risks and uncertainties, including volatility in the economy and the credit markets, supply and demand changes for vacation ownership and residential
products, competitive
conditions; the availability of capital to finance growth, and other matters referred to
under the heading «Risk Factors» contained in the Information Statement filed as an exhibit to our Annual Report on Form 10 - K for the year ended December 30, 2011 filed with the U.S. Securities and Exchange Commission (the «SEC») and in subsequent SEC filings, any of which could cause actual results to differ materially from those expressed in or implied in this presentation.
The company cautions you that these statements are not guarantees of future performance and are subject to numerous risks and uncertainties, including volatility in the economy and the credit markets, supply and demand changes for vacation ownership and residential
products, competitive
conditions; the availability of capital to finance growth, and other matters referred to
under the heading «Risk Factors» contained in the company's most recent Annual Report on Form 10 - K filed with the U.S Securities and Exchange Commission (the «SEC») and in subsequent SEC filings, any of which could cause actual results to differ materially from those expressed in or implied in this press release.
All phytocannabinoid (PCR) rich
products our partners produce, manufacture, or distribute, are either imported legally, or derived from 100 % Federally legal industrial hemp that is registered with the Colorado, Oregon, or North Carolina State Departments of Agriculture and conform fully to the 2014 US Farm Bill section 7606 which federally legalized the cultivation of industrial hemp
under certain federal mandated
conditions which we fully conform to.
«The entire conceptual systems of theology and ethics, developed
under the
conditions of patriarchy, have been the
products of males and tend to serve the interests of sexist society.»
The discontinuity of emergence is not a denial of continuity but its
product under certain
conditions.10
At a deeper level, as people are
conditioned to a consumer outlook, the church finds itself
under challenge to present the Christian faith in a way that meshes with people's desire for answers, and in a more pernicious way for a faith «
product», that will meet their needs with a minimum of effort and disruption.
These reusable containers are made of tough, durable high - density polyethylene for long - life performance
under the harshest
conditions and provides excellent
product protection.
This separation is necessary to control the sanitary
conditions under which the fully cooked
products are produced.
Resin suppliers formulate their
products to run well
under a broad range of industrial processing
conditions.
Developed with Cargolux to help minimize spoilage during transit, Tyvek ® Air Cargo Covers are ideal for shipping fruit, vegetable, floral, and pharmaceutical
products, even
under the roughest environmental
conditions.
(91) Yes — However, the use of cleaners not listed in tables 7.3 or 7.4 (PSL) is permitted
under specific
conditions laid out in 8.2.3 (32.310): 1) the efficacy of the alternative cleaning substance is documented; 2) the cleaning materials used are effectively removed from the
product contact surfaces, by an acceptable removal event (see 3.59 «removal event» definition) and that process documented; 4) the disposal of the effluent has been neutralized to minimize the environmental impact.
The software better reflects the likely stability of acidified
products under Australian
conditions than anything that was currently available.
A number of factors could cause actual results or outcomes to differ materially from those indicated by such forward - looking statements, including but not limited to, (1) our ability to open new restaurants and food and beverage locations in current and additional markets, grow and manage growth profitably, maintain relationships with suppliers and obtain adequate supply of
products and retain our key employees; (2) factors beyond our control that affect the number and timing of new restaurant openings, including weather
conditions and factors
under the control of landlords, contractors and regulatory and / or licensing authorities; (3) changes in applicable laws or regulations; (4) the possibility that the Company may be adversely affected by other economic, business, and / or competitive factors; and (5) other risks and uncertainties indicated from time to time in our filings with the SEC, including our Annual Report on Form 10 - K filed on March 30, 2016 and our Quarterly Report on Form 10 - Q filed on August 15, 2016.
If a low level of contamination can harm health in this way, labels should state that the
product is not sterile and may contain bacteria which could grow
under certain
conditions and cause harm.
Carriwell breast pads are manufactured
under controlled
conditions in Denmark to ensure the quality of these essential
products for nursing mums with sensitive nipples.
(17) The use of nutrition and health claims authorised
under Regulation (EC) No 1924/2006 to promote food for special medical purposes would not be appropriate, since consumers of such
products are patients suffering from a disease, disorder or
condition and are, therefore, not part of the general healthy population.
All DuraGo
products are independently tested for dyno performance, wear, and SAE 2521 noise protocols
under a variety of driving
conditions.
4.2.8 Supply single copies of articles (either digital or paper copies), from the Licensed Materials, to health professionals or other persons legitimately requesting medical information in relation to the medical, therapeutic or technical use and support of any of the Licensee's
products under the following
conditions only: (a) Such copies must be free - standing with no additional material affixed to or printed on them; (b) The copies must carry, without modification, those copyright notices already incorporated in the Licensed Materials; (c) Recipients must be instructed not to further distribute the copies; (d) This use of Licensed Materials is restricted to responding to enquiries (reactive use).
IITA field trials show that the
product can reduce aflatoxin by about 80 percent
under certain
conditions.
Under most reaction
conditions with most molecules, the Earth's magnetic field is far too weak — roughly 200 times feebler than a refrigerator magnet — to have any impact on the amount of
products produced.
These pumpkin - shaped modules are precursors to possible research labs or factories that could make
products under weightless
conditions.
About ten years ago, research results showed that things are not quite as simple as that: «
Under most
conditions, H2O2 is not an undesired side
product but rather an essential chemical messenger that plays an important role in regulating the way in which body cells respond to signals from outside such as hormones and growth factors,» says Dr. Tobias Dick of the German Cancer Research Center (Deutsches Krebsforschungszentrum, DKFZ).
«
Under those
conditions you get a very high conversion of all the carbon in the biomass into various gaseous
products,» says Arie Geertsema, Range Fuel's chief technical officer.
Taiwanese manufacturing giant Foxconn, which produces about 40 per cent of the world's electronics
products, including iPhones, has recently come
under fire over poor working
conditions and high suicide rates at its plants in China.
To make «clinical - grade» cells, scientists produced them without the use of any of the animal cells or
products typically needed, and did so
under certified manufacturing
conditions.
In addition to providing an unlimited supply of cells for implantation, the PEC - Direct approach has the potential to provide other advantages relative to cadaver islet transplants such as delivering a more consistent
product preparation
under quality - controlled cGMP
conditions, with a more straightforward and safer mode of delivery.
Please refer to technical documents
under the Documents tab for storage
conditions,
product components, and technical specifications.
To deliver a functional cure for all patients with type 1 diabetes and an important new therapy for patients with type 2 disease that require insulin to maintain control, ViaCyte is developing
products with numerous advantages including a virtually unlimited supply of cells manufactured
under quality - controlled
conditions, and a potentially safer and more optimal route of administration.
In addition to providing an unlimited supply of cells for implantation, the PEC - Direct approach has other potential advantages relative to cadaver islet transplants such as delivering a more consistent
product preparation
under quality - controlled cGMP
conditions, and a more straightforward and safe mode of delivery.
Under hypoxic
conditions activates the transcription of over 40 genes, including, erythropoietin, glucose transporters, glycolytic enzymes, vascular endothelial growth factor, and other genes whose protein
products increase oxygen delivery or facilitate metabolic adaptation to hypoxia.
Nested PCR was performed
under the same
conditions for 45 amplification cycles with 5 µl of the first round PCR
product and two different primer pairs, Gag - I - F (5 ′ - TCTCGAGATCATGGGACAGA - 3 ′) and Gag - I - R (5 ′ - AGAGGGTAAGGGCAGGGTAA - 3 ′) or NP116 (5 ′ - CATGGGACAGACCGTAACTACC - 3 ′) and NP117 (5 ′ - GCAGATCGGGACGGAGGTTG - 3 ′), respectively, both of which have been shown to detect both XMRV and MLV gag sequences [13].
By partnering with the Deconstruction Division, we are also able to determine how engineered crops grown
under different
conditions will impact downstream sugar and lignin intermediate yields, thus elucidating the linkages between genotype, phenotype, and
product yields.
(The FDA reasons that such
products are free of soy protein, which is only true when they are manufactured
under perfect
conditions.)
Under standard
conditions, 90 % of excess protein is turned into urea (a non-toxic waste
product) and excreted in the urine.
Under such
conditions [wherein low - protein diets suppress the activity of detoxification enzymes], the parent compound AFB1 would accumulate to cause greater acute toxic effects, whereas less
product (i.e., aflatoxin - DNA adducts) would accumulate to initiate carcinogenesis.
The FDA approved HIBC
under orphan drug status, which grants special status to biological
products used to treat rare diseases or
conditions.
We at Perfect Supplements take the manufacturing of all our
products very seriously and we want you to know that there is an experienced team working behind the scenes to guarantee you that our supplements are manufactured
under the best possible
conditions.
When wheat is digested in the body, certain compounds known as gluten exorphins (sometimes called gluteomorphins) are produced; interestingly, dairy
products under certain
conditions can also lead to the production of similar compounds known as casein exorphins.
Oils are simply amazing and
under utilized home
products that can help treat many ailments such as dry skin
conditions Angular Cheilitis.
Check with a qualified healthcare professional before using this
product if you are
under 18 years of age or if you have any pre-existing medical
conditions and / or are taking any prescription medication (s).
Warning: Any nutritional supplement should be used according to the directions on the
product label, and
under the supervision of an authorized healthcare professional, to be sure there are no undesirable interactions with existing medical
conditions or other prescribed medications.