Sentences with phrase «cycles of amplification»

One cycle of denaturing step (10 minutes at 95 °C) was applied, followed by 35 cycles of amplification (15 seconds at 95 °C and 1 minute at 58 °C), with fluorescence measured during the extension.

Not exact matches

This process is called amplification of the water cycle.

Previous research indicates that amplification of the water cycle, is happening at 7 per cent per 1 °C of global warming.

Amplification was performed with a thermocycler PTC - 100 (MJ Research Inc., Waltham, MA, USA), starting with 30 s at 94 °C, followed by 30 cycles consisting of denaturation (20 s at 94 °C), annealing (1 min at 55 °C) and extension (10 min at 65 °C) and a final extension at 65 °C for 10 min.

The following PCR cycle was used for miRNA amplifications: 95 °C for 10 minutes and 40 cycles of 95 °C for 15 seconds and 60 °C for 60 seconds.

PCR amplification was performed on genomic DNA using the primer pair forward: 5 ′ CTTGATTCTGGTATTGAGCCAGT 3 ′, reverse: 5 ′ TGAGCTGGTCTGAATGTTCG 3 ′, amplified for 35 cycles at an annealing temperature of 62 °C with Q5 polymerase (NEB) using the manufacturer's standard conditions.

It has been argued that the land amplification is associated with lapse rate changes (not represented in the UVic model), and it is certain that drying of the land can play a role (not reliable in the UVic model since diffusing water vapor gives you a crummy hydrological cycle, especially over land).

A-tailing, end repair, Illumina - compatible adapter ligation, and between 12 to 17 cycles of PCR amplification were performed.

Nested PCR was performed under the same conditions for 45 amplification cycles with 5 µl of the first round PCR product and two different primer pairs, Gag - I - F (5 ′ - TCTCGAGATCATGGGACAGA - 3 ′) and Gag - I - R (5 ′ - AGAGGGTAAGGGCAGGGTAA - 3 ′) or NP116 (5 ′ - CATGGGACAGACCGTAACTACC - 3 ′) and NP117 (5 ′ - GCAGATCGGGACGGAGGTTG - 3 ′), respectively, both of which have been shown to detect both XMRV and MLV gag sequences [13].

Within this region of the amplification curve, a difference of one cycle is equivalent to doubling the amplified PCR product.

Amplification conditions consisted of an initial 94 °C step for 4 min, followed by 40 cycles of 94 °C for 40 s, 52 — 55 °C for 40 s, and 72 °C for 1 min; and then a final extension of 5 min at 72 °C.

... Polar amplification explains in part why Greenland Ice Sheet and the West Antarctic Ice Sheet appear to be highly sensitive to relatively small increases in CO2 concentration and global mean temperature... Polar amplification occurs if the magnitude of zonally averaged surface temperature change at high latitudes exceeds the globally averaged temperature change, in response to climate forcings and on time scales greater than the annual cycle.

Polar amplication is of global concern due to the potential effects of future warming on ice sheet stability and, therefore, global sea level (see Sections 5.6.1, 5.8.1 and Chapter 13) and carbon cycle feedbacks such as those linked with permafrost melting (see Chapter 6)... The magnitude of polar amplification depends on the relative strength and duration of different climate feedbacks, which determine the transient and equilibrium response to external forcings.

There's little doubt that there is a great deal of polar amplification in the Northern Hemisphere during glacial - interglacial cycles.

Using the known amplification of the solar cycle (and presumably the long term trend) in the UV band, allowing stratospheric temperatures and circulation patterns to adjust and including the direct radiative forcings from the sun and volcanoes, we found that it gave temperature anomalies and spatial patterns that were in fair agreement with the observations (Shindell et al, 2003).

Dear RC, Is it not possible that scientists and mathematicians from the science of non linear dynamics (which maths I am presuming is being used in the maths of climate models) to shed light on the amplification and dampening of the climates feedback cycles and hence the so called «sensitivity» issue and hence the possible range of temperatures?

I am fairly confident the report will not mention the Pacific Centennial Oscillation, LIA recovery, NH land amplification, the stratospheric warming event cycles, the less publicized post 2009 proxy reconstructions, which all combined can barely push the «main cause» limit, because with the playing field shifted completely away from the meat of the debate CO2 forcing.

My take home message from the Shaviv paper is that some possible amplification of the expected cyclic temperature effects from the solar cycle may have been demonstrated, but that the quantitation is very uncertain.

We find that the total radiative forcing associated with solar cycles variations is about 5 to 7 times larger than just those associated with the TSI variations, thus implying the necessary existence of an amplification mechanism, although without pointing to which one.»

A greenhouse warming may reduce the 1,500 - year cycle aspects, but this provides us with no comfort regarding future prospects since a warming can shortcut the usual circuit, bypassing the usual stage - setting by amplification of the 1,500 - year cycle.

The galactic rays do not only «initiate clouds» and thus modify the reflexivity of the planet, but might also intensify / speed - up the water cycle or let it slow down — this being an amplification factor.

This is achieved through the study of three independent records, the net heat flux into the oceans over 5 decades, the sea - level change rate based on tide gauge records over the 20th century, and the sea - surface temperature variations... We find that the total radiative forcing associated with solar cycles variations is about 5 to 7 times larger than just those associated with the TSI variations, thus implying the necessary existence of an amplification mechanism, although without pointing to which one.

Since there is no secular change in TSI to speak of, amplification of the cycle wont explain 150 years of warming..

2) There was no noticeable Arctic amplification of warming, and the sea ice wasn't really thinning, but was rather going back to normal - under the influence of the solar cycle.

Basically it would be an amplification of the solar cycle, such that in addition to a small drop in TSI you would have the amplifying effect of more low clouds.

Simulations of the mid-Holocene with AOGCMs (see Section 9.2.1.3 for forcing) produce an amplification of the mean seasonal cycle of temperature of approximately 0.5 °C to 0.7 °C.