Sentences with phrase «different primer pairs»
Nested PCR was performed under the same conditions for 45 amplification cycles with 5 µl of the first round PCR product and two different primer pairs, Gag - I - F (5 ′ - TCTCGAGATCATGGGACAGA - 3 ′) and Gag - I - R (5 ′ - AGAGGGTAAGGGCAGGGTAA - 3 ′) or NP116 (5 ′ - CATGGGACAGACCGTAACTACC - 3 ′) and NP117 (5 ′ - GCAGATCGGGACGGAGGTTG - 3 ′), respectively, both of which have been shown to detect both XMRV and MLV gag sequences [13].
http://journals.plos.org/ Not exact matches
A new primer pair designed from the sequenced E gene TV - 3 (f) and TV - 3 (r) was used to detect viral genes in clinical samples collected from different affected regions in China.