Sentences with phrase «employed as»

Gustav H. is said to be the most perfumed man in Europe and is gainfully employed as the fussy head concierge at the eponymous Grand Budapest — a hotel situated near the painted backdrop of Carpathian peaks in Hungary, accessible by funicular.

In summary, women are under - employed as reviewers of film in the nation's 100 largest circulation newspapers.

Sally Hawkins gives a career - best performance with her sly, sensual, vulnerable portrayal of Elisa, a mute woman employed as a cleaner in a military research facility in Baltimore.

This inventive, episodic indie about a Senegalese immigrant employed as a Seattle bike cop suggested interesting things to come from Devor, who proceeded to make an avant - garde docudrama about a man fucked to death by a horse.

The film's «villain» is using the very medium her oppressors employed as a mask to force them to actually reveal themselves to each other.

Because they sit just outside the remit of what we might coin as «popular entertainment» (in short: they take ages to read), the term novel is now employed as a byword for a more cultivated, high quality and serious form of media.

Our everyman hero Emmet (Chris Pratt) is the happiest guy in Bricksville: he's gainfully employed as a construction worker (what else?)

I have been employed as a model for 8 yrs, i also enjoy writing songs, poems and plays.

camping and getting weird in the woods (~); -RCB- you get the picture Currently employed as a Sales Manager in the automotive industry and simply looking for a dance partner to fall...

asian girl likes daddys, doms, or being employed as the category Personals Perth WA Along the street prostitution, street.

A matured, loving and caring man gainfully employed as a manager in a leading financial service company

he wasn't on these types of 12 were employed as an ex numberwidow CRAIGSLIST WOMEN 40.

I am self - employed as an Interpreter and I am also a certified English and Spanish...

I'm at the happiest point in my life... been out of a dead end marriage now for over 3 years and self employed as a dog trainer now for 8 years and just loving it.

I am employed as an early childhood educator with a daycare in the Hamilton area.

The women must be sober minded permanently employed as I'm so that we can love each other and raise our kids.

I am self employed as an Electrical Contractor.

Currently employed as an EMT.

My interests are music, cooking, laughing, and women;) im self employed as a music producer and fashion designer.

Im self employed as an direct care provider.Currently caring for my elderly mom and my thirty four years old brother who has sever autism.

I am currently employed as an archive clerk in Dubai.

I employed as a Certified Nursing Assistant.

i am gainfully employed as a guard plus i have a trade as a auto mechanic with five years practical and a bit of teory.

I am employed as a substitute teacher.

Professionally employed as an...

This data is collected, saved and employed as a way of connecting you with the finest achievable matches, and is according to the data you supply.

I am Priya Arora employed as a high shape escort girl contribution you Independent Escorts service in Chandigarh.

But, in characteristic Chinese fashion of finding a medicinal use for virtually everything, these herbs were soon employed as medicines.

These are collectively employed as part of a structured program called cognitive behavioral therapy for insomnia (CBTI).

His professional career began in the Royal Australian Air Force where he was employed as a Fitness Instructor.

She received her clinical training during her Dietetic Internship at New York Presbyterian Hospital where she is now employed as a registered dietician.

They can be employed as accessory equipment for conventional weight training to increase or reduce the difficulty of exercises.

It was also employed as a cosmetic, body paint, food dye, and herbal medicine.

So I am currently employed as a CNA for a hospital & on the days of my shifts, I take anywhere between 8k - 14k steps on 8 - 12 hr shifts.

Long before the development of modern pharmaceuticals, silver was employed as a germicide and antibiotic.

For the last 4 years she has been employed as the Ketogenic Diet Coordinator for the North of Scotland, based in Aberdeen.

Are you learning about the chemical sciences whilst employed as an apprentice or trainee?

In recent years, the Burrows - Wheeler transform (BWT) and FM - index have been widely employed as a full - text searchable index for read alignment and de novo assembly.

Dr. Sakanoi received his Ph.D. from Tohoku University, where he is also currently employed as an associate professor of the Planetary Plasma and Atmospheric Research Center, Graduate School of Science.

Tonie E. Rocke, Ph.D., received training in Veterinary Science and Wildlife Ecology at the University of Wisconsin, Madison, and has been employed as a research microbiologist at the USGS National Wildlife Health Center since 1985.

Therefore, SCP1 and SCP3 were employed as markers to detect the meiotic stage in ES cell - derived germ cells.

Built from lignin and cellulose, his group's nanoparticle technologies are biodegradable, environmentally benign, and may also potentially be employed as foam and emulsion stabilizers; as drug delivery systems; and as matrices for environmental remediation systems.

An ingredient commonly found in toothpaste could be employed as an anti-malarial drug against strains of malaria parasite that have grown resistant to one...

In fact, the FDA has recommended that newer technologies be employed as soon they become available, to reduce the possibility of very serious off - target effects of therapeutic antibodies that bind to antigens in non-target tissues.

Ten microliters of a l / 1000 dilution of the first - round PCR product was employed as a template in a second PCR using PB (5 ′ - CGTACTGGAAAGTGCGGCTG - 3 ′) as the forward primer and P97 (5 ′ - GATGTTCAACTCATCCTGGTCCC - 3 ′) as the reverse primer [19].

When I finished my PhD, I was immediately employed as an assistant professor and young researcher at Universidad Tecnológica de Bolivar (Cartagena - Colombia) in 2016.

He was employed as an analytical chemist with the United States Army at the Edgewood Chemical Biological Center in Maryland, from 2002 to 2004.

He was previously employed as a scientist at NILU, and participated in several research projects in Bangladesh.

In 1754, he was regularly employed as a Depot Clerk of the Navy.

We are investigating the mechanisms for interindividual variation in the effects of aspirin as an antiplatelet drug employed as a cardioprotective agent.