Sentences with phrase «first as a template»

In fact, the sequel essentially uses the first as a template.

Not exact matches

And they worry that, since BitLicense is the first designated set of regulations for bitcoin businesses from a single state, other states will now follow New York's example and use BitLicense as a template for their own regulatory policy.

As one of the first pieces of major regulatory frameworks encompassing digital currencies and their associated technologies, BitLicense will likely serve as a template for regulators across the U.As one of the first pieces of major regulatory frameworks encompassing digital currencies and their associated technologies, BitLicense will likely serve as a template for regulators across the U.as a template for regulators across the U.S.

i actually created my first editorial calendar yesterday (in Excell) for an on - line portal i'm editing — in addition to your template it includes topics / categories as well, but your post and following comments gave me some great ideas to upgrade it.

I've tried searching the site but no luck can someone direct to where I can find a template as I'm having a hard time creating my first content calendar.

It was in some such way as this that the Christians of the first centuries, whom we call catholic, used Israel's story as a template for their own existence.

At the next stage, RNA molecules began to synthesize proteins, first by developing RNA adaptor molecules that can bind activated amino acids and then by arranging them according to an RNA template using other RNA molecules such as the RNA core of the ribosome.

In 1968 he argued that RNA must have been the first genetic molecule, further suggesting that RNA, besides acting as a template, might also act as an enzyme and, in so doing, catalyze its own self - replication.

Finally, microspheres can create polypeptides using polynucleotides as templates in a reverse of the process that formed the polynucleotides in the first place.

It seems like the board has a template of transfer policy in which first they buy a quality player like cech was last summer and alexis was before that and now it's xhaka.They just give you enough so that the guys who are season ticket holders would renew their tickets.Then the Dilly dallying begins we show as if we are going for top players and make cheap offers for them so the selling club would not sell them and they could say hey!

When the old guard led by David Dein sold us the vision, we trusted them to make it happen, we voted with our wallets, Kroenke came in and stole, and is still stealing that dream from us with Wenger as a convenient scape goat while our commonwealth is being raided, the sad part is that the situation has seen the spuds steal the template of that dream, and so far so good for them, a bigger club would have implemented it faster though but still, they are on course and at this rate, while we watch after our coffers, a small pub team like the spuds will overtake us, for the first time in the Premier League era, they finished above us, a situation not conceivable previously, shows how much the institution Arsenal has deteriorated in recent times.

It was actually the perfect template of a 2015 - 16 Leicester display in that way, as they got their first European win in 55 years.

«A child's first relationship, the one with his mother, acts as a template that permanently moulds the individual's capacity to enter into all later emotional relationships»

And once she writes the first letter for you, she will have a template to update for future letters, which increases the chance that an overcommitted professor will find the time to prioritize additional letters you will need as your training progresses.

Sosa and I pulled on latex gloves and carefully pipetted liquids into tubes to make our guide RNA from scratch — we first synthesized DNA strands with a specific sequence we wanted, used that as a template for the RNA, then destroyed the DNA and isolated the guide RNA from our test tube mixture.

But that insight showed him that the first layer of spheres could serve as a template.

In order to make glucose transporters, the cells must first make copies of the SLC2A1 gene to serve as a template.

Mre11 repairs double - stranded breaks in DNA by first chewing away one strand, exposing single - stranded DNA, which can be used as a template to repair the break.

Ten microliters of a l / 1000 dilution of the first - round PCR product was employed as a template in a second PCR using PB (5 ′ - CGTACTGGAAAGTGCGGCTG - 3 ′) as the forward primer and P97 (5 ′ - GATGTTCAACTCATCCTGGTCCC - 3 ′) as the reverse primer [19].

With SapTrap, the user first designs either oligos or synthetic DNA for the desired gRNA target sequence, as well as the 5» and 3» homology arm repair template (Fig. 1, Step 1).

There is no need for PCR or cloning, as digestion of the destination vector with SapI yields 2 sites - the first site accepts the sgRNA target sequence for U6 promoter expression and the second site accepts the homology arm repair template.

The first thing I did was cut the burlap using one of the craft triangles as a template.

Once I cut the first piece, I used it as a template to cut the other two sections of ribbon close to the same size.

Subsequent Career: Providing something of a template for screenwriters who want to make the jump, Steven Zaillian has continued as a high - profile screenwriter long after his directorial debut, only occasionally dipping his toe back in directorial waters, and never with the same straightforward success of his first time out.

Tim Grierson at Screen International: «In some ways, The Good Dinosaur is one of Pixar's most conventional films... But that template sets the stage for a mythic, visually resplendent treatment of familiar material, as first - time feature director Peter Sohn wrings considerable emotion from a tale that's part Western, part Incredible Journey - style adventure.»

It would be tempting to describe I'm Not There as being about six conflicting interpretations of Dylan, another Rashomon, another variant on Citizen Kane (a film that provided the structural template for Velvet Goldmine, Haynes's first shot at devising the method for this film).

Clinging closely to the template of the 1991 Best Picture nominee, its story, characters and songs will feel potently familiar to anyone who's seen the Mouse House's first crack at the tale as old as time.

Be the first to cross the finish line in this exciting board game, that tests the students spelling ability on words associated with their study of the VIKINGS Great opportunity to enhance themed vocabulary building Enlarge A4 to A3 playing board Large 89 cm x 72 cm poster (needs assembling), to use as an exciting wall display 16 starter words: longboat, monastery, sword, warrior... Make your scheme of work really stand out with this lively resource A blank template to create your own word bank cards and print out to be included in the game Dazzling certificate for winners Something for everyone

It is recommended that teachers complete this template first before entering their SLO into Teachscape, and also attaching it as an artifact and evidence of their SLO.

They could use as a template for Math the pre-common core standards that put California first in the nation; and for English, the acknowledged best were pre-common core Massachusetts.

Below is a sample of the first draft templates that contain the definitions, as well as an example using Cinderella for each section.

The BMW 2002 turbo, launched in 1973 with a four - cylinder, 125 kW / 170 hp engine, was the first European production car to be fitted with an exhaust gas turbocharger, and is still regarded as a the template for a compact, high - performance driver's car.

And if you're first prompted to make those judgments by an agent's query form template, let that serve as an important reminder of the risk you take by publishing through any means without having answered them ahead of time for yourself.

If you're just getting started on your chapters, it's best to design one of your more complex chapters first, then use that chapter as a template for all the remaining ones (i.e., «Save As» Chapter 1, delete all the original chapter's text, place the Chapter 1 text, and thereby leave the trim size, margins, and styles intact and consistent among all chaptersas a template for all the remaining ones (i.e., «Save As» Chapter 1, delete all the original chapter's text, place the Chapter 1 text, and thereby leave the trim size, margins, and styles intact and consistent among all chaptersAs» Chapter 1, delete all the original chapter's text, place the Chapter 1 text, and thereby leave the trim size, margins, and styles intact and consistent among all chapters).

Her work first became popular (and controversial) not because she took J.K. Rowling's world and imagined all - new stories, but because she used it as a template in which she could fit in all of her other pop culture fandom — inserting quippy exchanges from Buffy the Vampire Slayer and passages from authors like Pamela Dean (as this expose detailed) with only minimal changes.

This was my second video so although it's still not perfect it did take some time to make (not as much as the first since I had a template to work from) so I'd appreciate any support you're able to give for all my hard work.

First, a trading plan should be thought of as a template for trading the markets.

Once you've customized your first chart template, you're ready to create as many as your practice needs!

The first feature that was talked about was VR project templating, which is said to make those who are starting new projects get into it easily, as it helps with basic movement and animation.

But while Vampire Killer is by no means a bad game, most consider Castlevania as the template for the first ten years of the franchise, and its rigid physics and highly deliberate level design have yet to be matched.

Covering all eight main Mega Man X games (plus the Maverick Hunter X remake of the original Super NES game for the Sony PlayStation Portable), the two Game Boy Mega Man Xtreme titles, and the Command Mission RPG, this edition of Official Complete Works follows a similar template as the first book.

Just two years later, he had created the first of his so - called «cross paintings,» a template of abstraction that he would follow for the next three decades as the contemporary Chinese art world made its own great leap forward.

Irene Shum Allen (Curator and Collections Manager, The Glass House) provides us with an introduction to Philip Johnson as an art patron, and presents three major works on display at The Glass House: an outdoor sculpture by Donald Judd (Untitled, 1971), which is believed to be Judd's first outdoor site - specific installation; the painting Averroes (1960) by Frank Stella; and Bruce Nauman's neon sculpture Neon Templates of the Left Half of My Body Taken at Ten Inch Intervals from 1966.

The above code would go into a separate textarea under PHP Code than the first example — although the Custom Field Template PHP Code section only starts with one textarea, once you add text to it a new one is added; this continues as you edit each new textarea:

Last updated in November 2012, this template was first published in 2008 and has been updated a number of times over the years as social media has developed.

We spent a little bit of time, first, with people, or at least our computer system does, helping them to better understand their legal problem and to give them plain language, legal information up front, as well as some self - help tools like template letters that they can use to, for example, send their neighbor a letter outlining their position and offering to resolve the dispute somehow.

Customizing the watch Face is the first time you'll use Force Touch: you push a little bit harder on the screen, and you can swipe between Apple's selection of watch face templates, each of which can be customized and saved as individual variations.

Industry insiders claim that Amazon used the BlackBerry PlayBook hardware template as a basis for its first - generation Kindle Fire tablet.

Released as part of the update is its first «Quickstart Template», a tool designed to make it easier for Project Bletchley users to spin up a consortium using a private version of the ethereum blockchain.

A great simple one - page resume template for job seekers in traditional industries, as well as students targeting their first job.