Sentences with phrase «follow the sequence from»

4 weeks worth of daily teaching of phonics which follow the sequence from LCP Phonics.

Not exact matches

Her work has explored why fewer drugs are developed for children, chronicled the sequencing of her own genome, and followed the manufacturing of a flu shot from egg to pharmacy.

The analysis for this projection on wealth difference from withdrawal sequence is based on the improvement of withdrawal capability following tax efficient withdrawal sequence among multiple account types in a 10,000 - iteration Monte Carlo simulation.

The movement from Nazareth to Galilee is followed by one from Galilee to Jerusalem; and in his sequel, the Acts of the Apostles, the Evangelist will continue the progress to Rome itself again, if the writer of the Fourth Gospel radically departs from the topographical scheme of his predecessors, his whole presentation is dominated by references to an hour «that is not yet come», but which controls and directs by its ever hastening approach the sequence of events he sets forth.

From which it follows, ultimately, that the self must be regarded as a series of momentary selves the unity of each of which can only be regarded as the unity of a complex set of what I will refer to as «interrelated event - cells,» while the unity of the more general sense of «person» or «self» can only be regarded as the unity of a sequence or succession.

Moreover, both Matthew and Luke normally follow Mark's order of events, but, when one departs from the Marcan sequence, the other supports Mark's order.

The blurb from the atheist site shows that atheists want to dodge the burden of proof that comes with stating that «God does not exist» by saying they only «disbelieve», however that is immediately followed by a sequence of statements that confirm a denial of all things super natural.

There's a breakfast and morning tea sequence that takes you from a scrumptious Apricot and Macadamia Granola and then breakfast is repurposed into a tray of yummy Apricot Muesli Bars for the kids and then a nutritious Breakfast Smoothie Bowl the following day.

Point 4 may organically follow on from point 1 However the footballers preference Is usually the 1, 2 sequence As described above (but not always).

Beeeeeeeeautiful passing sequence that starts from center ice following a neutral zone turnover goes Provorov to Ghost to Couturier to Giroux to Konecny, the last of whom taps the puck past Price.

The first block of the sequence arrived on the right - hand side of the Town penalty area to deny former Terrier Scott Arfield from centering for a waiting figure of Chris Wood, before Steven Defour's attempted one - two with Wood came to a premature halt following Schindler's superb awareness to step in - front and clear the danger.

The last 12 meetings have seen honours equitably shared with 4 wins for each team and 4 draws; a sequence that includes our solitary win at the King Power stadium following the Foxes move from Filbert Street in 2002.

Owen Coyle will have no doubt hand - picked plenty of positives from a festive period which didn't exactly reap may rewards in terms of points, though even the potential manager of the season will have his fair share of concerns regarding his team's current frame of mind following ta three - match sequence without registering a win in the league, a run that probably wasn't remedied by a 2 - 0 FA Cup third - round victory over Conference side York City simply because it was scruffy and very fortuitous, not to mention required Coyle to draft in his big boys in the dyeing embers of the game.

By sequencing the genomes of 7 hunter - gatherers excavated across Scandinavia and dated to be 9,500 - 6,000 years old, the researchers found that migrations into the Scandinavian peninsula most likely followed two routes; one from central Europe and one from the Northeast along the Norwegian Atlantic Coast.

Follow how sequencing technologies have evolved from Sanger sequencing to the present, together with useful genomic information.

Genetic similarity across the sequenced 2014 samples suggests a single transmission from the natural reservoir, followed by human - to - human transmission during the outbreak.

In the next phase of the study, researchers will genetically sequence tumor cells from at least 500 patients and follow the course of their disease.

Subsequent sequencing of the nuclear genome followed, revealing that the pinkie came from a previously unknown hominid group, similar to Neanderthals, that migrated east toward Asia while Neanderthals migrated west.

But the following year the Poinars made a huge leap back in time when they managed to sequence the DNA from a weevil which was 130 million years old.

In the new nomenclature, genetic sequences are labeled «genseq,» followed by a reliability ranking (e.g., 1 if the sequence is from a primary type), followed by the name of the genes from which the sequences were derived (e.g., genseq - 1 16S, COI).

Asara estimates that collagen protein represented less than one one - hundredth percent of the material he received from Schweitzer, but following a difficult process of extraction and purification, he found six protein fragments, or peptides, that could be sequenced.

Auchtung and colleagues sequenced genetic material from the stool, saliva and food of healthy adults following the consumption of different controlled diets.

Therefore, in 2015, the DNA was extracted from the teeth and, following hybridization capture of the mitochondrial and Y chromosome fractions, sequenced by a next generation method.

The most commonly used form of Cas9, derived from the bacteria Streptococcus pyogenes and known as SpCas9, recognizes PAM sequences in which any nucleotide is followed by two guanine DNA bases.

Schiaparelli was programmed to autonomously perform an automated landing sequence, with parachute deployment and front heat shield release between 11 and 7 km, followed by a retrorocket braking starting at 1100 m from the ground, and a final fall from a height of 2 m protected by a crushable structure.

The coding sequence of chicken Acvr1 was PCR amplified from chicken embryo cDNA using the following primer pair: chAcvr1 - NcoI - fwd, 5 ′ - ACCATGGCTCTCCCCGTGCTGCTG - 3 ′ and chAcvr1 - BamHI - rev, 5 ′ - AGGATCCTCAACAGTCAGCCTTCAGTTT - 3 ′.

DNA from the individual VHH that neutralized any tier 2/3 viruses to < 20 % seen with control was purified, sequenced, and recloned into the pCAD51 expression vector followed by transformation into TG1 cells for purification and further characterization.

Because of these false positives, a sequence of tests - as originally outlined by Alonso et al. (2004)- is employed, beginning with detailed revisions of the detection light - curves, and continuing for surviving candidates with follow - up observations, to either reject them from the list of planetary candidates or to verify their planetary nature.

Following the isolation and purification of microbial DNA from all samples, we used community fingerprinting (ARISA) and high - throughput sequencing of the 16s ribosomal RNA gene (V1 - V3) to describe the microbial community structure in each group.

The goals of the project are as follows: (1) to shotgun sequence the C. murisgenome to 8X coverage; (2) to sequence 20,000 clones from a C. muris cDNA library to provide gene prediction training and verification data; and (3) to manually annotate the C. muris genome sequence in comparison with the genome sequence data for C. parvum and C. hominis.

The sequences of small interfering RNA (siRNA) targeting the human mTOR, AKT1, and 4E - BP1 gene products were purchased from Ambion, Inc. (Austin, TX) and were as follows: mTOR sense GGAGUCUACUCGCUUCUAUTT and antisense AUAGAAGCGAGUAGACUCCTC, AKT1 sense GGGCACUUUCGGCAAGGUGTT and antisense CACCUUGCCGAAAGUGCCCTT, and 4E - BP1 sense GGUACCAGGAUCAUCUAUGTT and antisense CAUAGAUGAUCCUGGUACCTC.

To identify orthologues, genes from the following eleven genome sequences were clustered using OrthoMCL28 (version 1.4): the present P. cynomolgi M, P. vivax P0129, P. falciparum 3D730, P. reichenowi CDC31, the re-annotated P. coatneyi, the rodent malaria parasites (P. yoelii, P. chabaudi and P. berghei32), P. knowlesi33, P. malariae and P. ovale curtisi34.

A planned sequence of three liquid - argon detectors will provide new insights into the three known types of neutrinos and seek a yet unseen fourth type, following hints from other experiments over the past two decades.

In the article that follows we outline, why the «perfect genome» in humans is important, what is lacking from current human whole genome sequences, and a potential strategy for achieving the «perfect genome» in a cost effective manner.

Companies report that the administrative burden for voluntary compliance with the Guidance is substantial; we estimate, based on reports from the IGSC, that sequence screening and follow - up on pathogenic and potentially pathogenic sequences accounts for 1.5 — 3 % of total costs.

DNA from two large families affected by EDs was collected, and mutations segregating with illness were identified by whole - genome sequencing following linkage mapping or by whole - exome sequencing.

We isolated a dozen of the BYDV strains (four from Beijing, two from Hebei, three from Shandong, one from Jiangsu and two from Jiangxi, respectively) from the affected duck brain and ovary tissues in total but focused on a single strain (BYDV - byd1) for the following studies, including genomic sequencing.

Then in 2005, another piece of the puzzle fell into place when researchers discovered that the short sequences between the repeats weren't from the bacteria themselves, but were actually viral DNA that had been added to the bacterial genome following an infection.

Following the sequencing and assembly of a Joshua tree reference genome, we are working to understand what genes underlie Joshua tree's adaptation to the extreme climates in which it grows, from the margins of Death Valley to the high desert.

Hex cDNA tagged with a recognition site for the bacterial BirA ligase (B), followed by an artificial IRES sequence composed of a tandem array of reiterated 9 bp elements from the Gtx promoter and DNA encoding the fluorescent reporter, Venus, was inserted into the first exon of the Hex locus.

Following the development of a computational pipeline, including a new de novo assembler for RNA virus genomes, to generate larger contiguous sequences (contigs) from the abundance of short sequence reads that characterise the data, another area that determines genome sequencing success is the quality and quantity of the input RNA.

In 2006, sequences corresponding to a novel gammaretrovirus named xenotropic murine leukemia virus - related virus (XMRV) were identified in tissue from prostate cancer patients following radical prostatectomy [1].

An Animated History of Reproduction Part cloning experiment, part documentary, Stories from the Genome follows an unnamed CEO - geneticist whose company sequenced the Human Genome in 2003 — a genome that secretly was his own.

Anyone can download the source - code from GitHub, run genetic - sequencing data for the outbreak they are following through the pipeline and build a web page showing a phylogenetic tree, or genetic history, of the outbreak.

Derived from Ashtanga, the nouveau style follows a sequence decided by the teacher (good for variety junkies).

They follow in sequence from beginner to advanced.

Sun Salutation B Follow this sequence: From mountain pose move into chair pose with feet together in a low squat and arms straight above your head.

Most sequences are linear, that is one posture follows another in a logical step - by - step direction, moving from less challenging to more challenging and back to less challenging.

If you need more time to recover from your workouts, you can train 2 days on and 1 day off picking up the next workout in the sequence on the following training day.

The following sequence of poses is an ideal way to wind down from your day and prepare for bedtime.