Sentences with phrase «following codes using»

At the title screen enter the following codes using your controller (you should hear a noise confirming that you entered the code correctly).

Not exact matches

Retargeting is a cookie - based technology that uses a simple Javascript code to anonymously «follow» your audience all over the Web.

For instance, you can do code reviews to make sure you're following your design patents, take the time to fix any bugs that have popped up and use what you've learned from the beginning of the project to adjust your plans for finishing it.

Using their cell phones, consumers will type in a keyword (which customers select) followed by a common short code, which is a special phone number.

Until now, advertisers have used cookies (small bits of code automatically downloaded onto your computer) to follow you around the web and measure the performance of online ads.

The following pieces of code are simple to use but will provide your retargeting efforts with the extra power they need to really blow things out of the water.

The following pieces of code are simple to use but will provide your retargeting efforts with the extra power they need to really

The basics of W3C compliant code should be followed: relevant and optimized title tags kept under 70 characters, descriptive meta descriptions, relevant header tags that echo or subtly modify the title tag and then narrow the focus with subsequent tags, and wise use of bulleted and numbered lists, bolding, and emphasis.

Code - a-Thon contestants used open source distributed ledger technology and health - specific standards to address one of the following health IT.

To take advantage of this offer, head to the website Gourmet Raw and use the following code — GR006

Via online bank transfer, making a payment of # 30 (or # 42 for addresses outside of the UK) to — Account name: The Gooner Sort Code: 20-76-90 Account Number: 03004112 Use the reference 1819 followed by your surname.

These two teams were favourites going in to the competition and if you are thinking about backing either then I suggest you check out the guide to the bet365 promo code so you can use the bookies money to follow your team.

Liverpool have long been linked with a move for Ilkay Gundogan - you can bet on his next club using a code available on Stan James - and the rumours touting the German international with a switch to Anfield has further intensified following the arrival of former Dortmund boss Jurgen Klopp as manager at Merseyside a few months ago.

Founding Moms grants you the rights set forth herein, subject to the following conditions: (i) you shall not modify, disassemble, reverse engineer or otherwise reduce to human - perceivable form all or any part of the Services; (ii) you agree not to submit or transmit any emails or materials through the Services that contain a virus, worm, Trojan horse or any other harmful component; (iii) you shall not obtain or attempt to obtain any data through any means from the Services, except if we intend to provide or make it available to you; (iv) you shall not copy or imitate part or all of the design, layout, or look - and - feel of the Services or individual sections of it, in any form or media; (v) you are responsible for the accuracy and quality of the data and content that you submit; (vi) you shall not submit content that is offensive, including without limitation, bigotry, racism, discrimination, hatred, or profanity; (vii) you will use commercially reasonable efforts to prevent unauthorized access to and / or use of the Services, and to notify Founding Moms promptly of any such unauthorized access and / or use; and / or (viii) you shall not use the Services for any unlawful purpose or to violate any federal, state, international law, code of conduct or other guidelines which may be applicable to the Services provided.

Because the UK Infant Formula and Follow - on Formula Regulations (2007) has failed to implement at the International Code of Marketing of Breastmilk Substitutes and subsequent, relevant World Health Assembly Resolutions correctly, companies are able to use follow - on formula advertising to promote unnecessary and expensive products with misleading cFollow - on Formula Regulations (2007) has failed to implement at the International Code of Marketing of Breastmilk Substitutes and subsequent, relevant World Health Assembly Resolutions correctly, companies are able to use follow - on formula advertising to promote unnecessary and expensive products with misleading cfollow - on formula advertising to promote unnecessary and expensive products with misleading claims.

In addition, where follow - up formula is otherwise represented in a manner which results in such product being perceived or used as a partial or total replacement for breastmilk, such product also falls within the scope of the Code.»

For 2000 - 2013, cause of death is determined using the following ICD - 10 codes: SIDS (R95), unknown cause (R99) and ASSB (W75).

If you are interested in getting a pouch sling of your own, just follow the links and remember that at Along For the Ride you can use coupon code «MAMANISTA» for $ 5 off your order of $ 40.00 or more or you can get 10 % off Attached to Baby's selection of baby carriers with coupon code MAMANISTA10!

Codes For Banner Links Use one of the following codes to link back to me using a graphic instead of text:

The format uses easy - to - follow chapters including important questions any parent - to - be might have, as well as summaries and QR codes for video clips.

Rev. Code § 43.70.640 (2001) allows any employer, governmental and private, to use the designation of «infant - friendly» on its promotional materials if the employer follows certain requirements.

Cases of postpartum hemorrhage were identified using ICD - 9 codes 666.0, 666.1, 666.2 and 666.3 and ICD - 10 codes O720, O721, O722 and O723 for postpartum hemorrhage due to retained placenta (third stage hemorrhage), uterine atony (immediate postpartum hemorrhage, within the first 24 hours following delivery of placenta), delayed and secondary postpartum hemorrhage (after the first 24 hours following delivery) and postpartum hemorrhage due to coagulation defects, respectively.

From a constituent viewpoint, when you first log in via mobile phone or Facebook, the app will set you up to «follow» the President, your two Senators and your Representative using basic demographic information (such as your zip code) you'll be prompted to enter.

If you haven't been following the recent saga of the online crusade to distribute the magic code used to crack hi - def video disks, you've missed a fascinating example of...

NOTICE is hereby given the following industry was in significant non-compliance in 2016 of the Sewer Use Ordinance Chapter 75 of the Municipal Code of the City of North Tonawanda, New York.

The FSB is calling on the Government to ensure that all public agencies follow the lead of central Government and pay all invoices to small firms within 10 days; that all contractors that the public sector uses pay their sub-contractors within the same time; and that all private sector companies used by the public sector sign up to the Prompt Payment Code.

(c) The terms «President - elect» and «Vice-President-elect» as used in this Act shall mean such persons as are the apparent successful candidates for the office of the President and Vice President, respectively, as ascertained by the Administrator following the general elections held to determine the electors of the President and Vice-President in accordance with title 3, United States code, sections 1 and 2.

Drafted language follows the reasoning that if landing helicopters in residential zones is not an allowed use in the code, it's not an allowed use at all, town attorney Bill Duffy said at last Wednesday's Town Board work session.

For example, the number 385 would be coded by 3 linked knots, followed by a space, then 8 linked knots, a space, and then a special long knot, used only for numbers 2 through 9, with 5 turns to express the number 5.

Similarly, many commercial robots can follow guide wires installed below the surface they move over, and some orient themselves using lasers that read bar codes on walls.

All of this makes for a headache for those trying to sort out appropriate building codes and engineering designs; to try to bring some harmony to the dispute, the latest hazard assessment incorporated a model that followed some of Stein's ideas, including using GPS to detect tectonic strain in the region, as well as the data from NRC.

(Technical note: To create the online form, I used Simpletext, using «hand coding» and following Castro's suggestions.

To retrieve their files, they used modern sequencing technology to read the DNA strands, followed by software to translate the genetic code back into binary.

The coding sequence of chicken Acvr1 was PCR amplified from chicken embryo cDNA using the following primer pair: chAcvr1 - NcoI - fwd, 5 ′ - ACCATGGCTCTCCCCGTGCTGCTG - 3 ′ and chAcvr1 - BamHI - rev, 5 ′ - AGGATCCTCAACAGTCAGCCTTCAGTTT - 3 ′.

Phylogenetic inference was carried out using a partitioned (codon positions 1 — 2 and 3) supermatrix of 20,384 protein - coding genes from Ensembl v72 (80) following quality filtering, using the longest transcript for each gene.

By using the nanocomplex in conjunction with computer programme codes and imaging software, the researchers were able to follow how mRNA expresses itself during neural stem cell differentiation.

We first calibrated the whole - exome phylogeny using the time to the most recent common ancestor (TMRCA) of Equus (donkey vs. horses) at 4.0 — 4.5 Mya (9) and tip dates for ancient samples, assuming that the combined evolution of protein - coding genes follows a molecular clock (Fig. 2A).

In conjunction with these strains, several cre transgenic strains have been created where BAC engineering was used to insert an intron containing cre or creERT2 cassettes, followed by a polyadenylation sequence to terminate transcription of the fusion transcript immediately after the recombinase gene, into the BAC vector at the initiating ATG codon in the first coding exon of the gene.

Share this infographic using the following embed code.

Or, just follow my lead and go with New Year's cards to give yourself some breathing room and use code WINTER16 to save 15 % on your order!

If you can't wait, you can sign up to Gousto and get 50 % off your first box by following this link and using the code SAVE50.

Thank you to eShakti, be sure to follow them on Instagram:) And for my readers, I'm giving you my special promo code «Shoesandsashimi» to get 10 % OFF when you shop at eShakti — valid for unlimited use from 09/08/2015 — 10/08/2015.

Next, head over to White House Black Market (follow them on Twitter - @whbm) and use code 9377 through October 9th to score 25 % off all dresses!!

After scouring the site, I have found the following promo codes to use through midnight tonight (4/5)!!

We did receive free products in exchange for sharing the following discount code for you to use while shopping for your Easter treat supplies.

Please feel free to use our dating infographic on your own website using the following HTML code:

Just use the following macros together with the tracking code and assign different values to the tracking code variables depending on the gender and age of the person:

Some of you may already have them, but I usually update and post Wheelchair Bases - Product Classification List The following product list identifies the correct HCPCS code to be used for specific wheelchair bases.

If you like it, you can bookmark his level, or use the following code in Super Mario Maker, in order to play it: F93B -0000-024C-3C40.

You can check it in the video below, and if you're interested, you can bookmark his level (or use the following code in - game: 6532 -0000-0251-F920)!