Sentences with phrase «following primers»
Quantitative reverse transcriptase PCR (qRT - PCR) was conducted using the SYBR Green qPCR Kit (Fermentas) by using following primers: Actin F: TGAGACCTTCAACACCCCAGCCATG, Actin R: CGTAGATGGGCACAGTGTGGGTG, KLF4 F: GTCTTGAGGAAGTGCTGAGC, KLF4 R: ATCGTCTTCCCCTCTTTGGC.
cancerres.aacrjournals.org
For each condition, 200 ng genomic DNA was then PCR amplified using Platinum Taq High Fidelity (Invitrogen) using the following primers plus 454 adaptor sequences and 8 letter DNA barcodes: CAACCTCTACAGCAGTGTCCTCATC (forward) and GGAGTGTGACAGCTTGGAGATG (reverse).
The following primer gives a good overview of No Kill.
The following primer summarizes the key points in Judge Aldisert's article.
The following primer was prepared as a result of numerous requests by clients seeking information about the scope and effect of the recently - enacted «serious offence» regulations.
To genotype the DRD2 TaqIA polymorphism, the following primers and probes were used: forward primer, 5» - GTGCAGCTCACTCCATCCT - 3», reverse primer, 5» - GCAACACAGCCATCCTCAAAG - 3», probe 1, 5 «VIC - CCTGCCTT GACCAGC - NFQMGB - 3» and probe 2, 5» - FAM - CTGCCTC GACCAGC - NFQMCB - 3» [34].