Sentences with phrase «for easy template»

I came to Etsy for an easy template and upgrade.

This negates the risks inherent to handing off the work to non-subject matter experts and allows for easy template maintenance.

I cut a piece of yarn to my desired length for an easy template.

Not exact matches

For these reasons you should create email templates so that saying «no» is just a little bit easier.

I use Maropost, because it's easy to use and has a lot of features and templates that work well for me.

Amazon Web Services has announced the launch of its blockchain templates, which will make it easier for developers to create blockchain - based projects...

In an attempt to make it easier for their Amazon Web Services (AWS) clients to create blockchain - based solutions, the company introduced «AWS Blockchain Templates».

Just as checklists help your leads perform recurring tasks with more ease, there may be templates you can create for your leads in Excel, Word, Photoshop, etc. that would help them do something easier or better.

Ask yourself what problems your leads and customers encounter, and whether there are templates you can quickly create and offer for download to make that job easier.

Get ready for Halloween with these easy and simple pumpkin carving tips, no matter what jack - o - lantern template you are using.

I use the plugin called Easy Recipe Plus for my recipes and you can use the plugin to stylize the template to match your blog.

Mark Reinfeld uses the Template Recipe format to make it easy for the reader to change the recipes.

These templates should be easy to use for even a beginner at Photoshop.

Homemade toys that double as recycled crafts for kids are a blast to make, and the free printable template included makes this project super easy.

Day 8: Today I have for you these VERY awesome Funky Elephant Superhero Capes.My kiddos had a ball making their capes, I absolutley LOVE how everything was all included in the package, all we needed was a pair of scissors and our imagination, got to love that!This super cute cape came in the package, it has a velcro fastening for going around your kiddos neck / shoulders, making it so easy to put them on and take them off.The package also came with some templates and sheets of adhesive felt and a couple of foam stickers.

When that felt set wore out, I decided to create a new felt nativity scene template — one with pieces that would be very easy for my children to set up and take down.

Invitations are the easy part when you're throwing a baby shower with a Valentine's Day theme — just use your favorite template for homemade Valentines, or one of these free printable Valentine baby shower invitations.

You could put in ticket requests for new designs but it wasn't as easy for the user to install new templates, etc..

I understand that as a newbie, templates are the easiest way to get started, but for anyone with basic HTML / CSS experience and some patience with Joomla Forums and tutorials, you can make a Joomla website look like anything.

I have an easy - to - use Filemaker template that I use for just such a database, and any information that I pick up in my daily networking goes directly into that file so that I can access it later.

To determine the p53 status in individual HCC samples, cDNA templates (1 μg) from 45 HCC samples were mixed with the primer set p53 -1-F, ATGGAGGAGCCGCAGTCAG, and p53 -1181-R, TCAGTCTGAGTCAGGCCCTTC, and high - fidelity Easy - A Hi - Fi PCR cloning enzyme (Stratagene) for PCR reactions.

Free, pre-formatted, poster templates are available to make it even easier for you to create your poster.

This easy - to - make granola recipe can be used as template for different variations.

This is a wonderful template for a delicious and easy gluten free muffin recipe.

She covers how to make the transition step by step, and provides recipe templates for easy - to - make meals for breakfast, lunch and dinner.

Find our printable templates and DIY tutorials to make easy felt crafts for home decor, holidays, handmade gifts, kid's crafts and more.

So to make it easy for us, I created these fun Instagram Story Templates.

And for the untalented or squinty eyed among us, drawing up a template and sticking it under the see through stuff as you stick on the rhinestones might make it easier to keep everything symmetrical!

I'm going to give you the EmLovz Online Message Template so you can try Mega-Messaging for yourself the easy way.

I started with Dating Factory at the start of 2010, and it has been by far the easiest platform to use, with high quality templates, fantastic language options, good niche discreet databases, excellent tracking facilities for PPC conversions and good retention rates for recurring payments experienced so far.

Save up to 5 search templates with various preferred categories for easier matching every time you sign in

Easy to edit one page resume template design for Indesign, Illustrator, Photoshop.

Find our printable templates and DIY tutorials to make easy felt crafts for home decor, holidays, handmade gifts, kid's crafts and more.

【 Landing Page Templates 】 100 % Satisfaction - see customer reviews, consult live chat sales 【 Premium Features 】 Responsive An online dating site free to join for unintrusive flirting and uncompromising dating with easy - going singles living in your area.

Easy might include filling out your height, while hard might include coming up with a good These online dating profile examples for men will give you templates, tips, and inspiration to create a dating profile that helps you get more attention.

Although it certainly uses that template as a jumping - off point, «Dean» eventually settles into its own rhythm thanks to Martin's unique style, particularly the way in which he utilizes his simplistic drawings (often via split - screen) to illustrate Dean's current mood or just for an easy laugh.

Using Secret Wars as template for the next Avengers film would provide an easy way for Earth heroes to realize that they need to expand and connect with other cultures «out there,» so they can be ready for whatever the next threat is.

It is possible that the tale of Anna (Kristen Bell) and Elsa (Idina Menzel) could just be a tweak to the standard princess template, but projecting a LGBT theme onto the picture makes it a much easier target for criticism and gives Swanson a soapbox to stand on.

eLearning templates have made life easy for graphic designers and online learners alike.

When expectations for deadlines are clear, templates are in place, and questions are answered in advance, the planning is much easier on teachers.

Three Step by step guides, easy and clear for students to follow and understand Using the ribbon: Main Sections / hiding / showing paragraph marks Headers / Footers: Automatic Date / Page Numbering Templates: Using existing to create a CV / creating your own template

Finally, an easy win is for schools and trusts to review their HR policies much more critically, not just implement a boilerplate template but make sure they suit the needs of the employer to ensure all lessons are at least good.

Teachers can download templates, clip art, hotlists, and so on, for easy and safe access by students.

These DIY Christmas ornament templates are easy for any...

Can easily be adapted to make easier / harder or used as a template for a...

This also makes the on - boarding process a lot easier for you as well, as once you have a templated learning plan for a particular staff member, if you are hiring someone to fill the same job role, you will already have a copy of all the training they need to complete ready for you.

Each page of this easy - reader contains a simple and predictable sentence with a feeling word to trace and a blank face template for students to draw the facial expression on.

Create intuitive PowerPoint Presentations by using Baby PowerPoint Template — Download Collection of Baby PPT Background, Themes and Backgrounds for PowerPoint Presentations You can download @ 19.99 $ only at >> > http://www.templatesvision.com/product/others-ppt-templates/baby-powerpoint-template/ Key Features of Baby PowerPoint Template * Simple color - coded format * Easy to use with Text * Facilitates communication with customer * Save hours on making presentation * Attractive charts and diagrams * Reasonable price * Slides — 21 Slides

For the easy integration of games in learning, organizations can buy easy - to - modify game templates.

These DIY Christmas ornament templates are easy for anyone to make.