Sentences with phrase «for master volume»

Included is a pair of 50 mm over-ear speakers, a detachable mic, and in - line controls for master volume and mic muting.

Not exact matches

In Illusions in Art for Young Eyes at the Leigh Yawkey Woodson Art Museum, contemporary master Eric Conklin borrows tools such as conical mirrors from 17th - century Dutch artists and mathematical principles from ancient Egyptian architecture to create a sense of depth when there is none or to imply volume when only area exists.

The wells of a 96 - well optical reaction plate were loaded with a 20 - μl volume consisting of TaqMan 10 × PCR Master Mix, cDNA diluted in sterile H2O, and either a primer mix for the gene of interest or the housekeeping gene 18s.

The gene expression from every sample was amplified in triplicates, with a single volume of 10 µl containing: 3 µl of diluted cNDA with 0.5 µl of primer set (see Table 1 for primer sequences), 1.5 µl double distilled water (DDW) and 5 µl of GoTaq qpcr Master Mix Kit (Promega, USA).

Quantitative PCR was conducted in triplicate in an Applied Biosystems MicroAmp Optical 96 - well Reaction Plate with a 25 µl reaction volume containing 12.5 µl of Thermo Scientific Maxima SYBR Green / ROX qPCR Master Mix, 2 µl of purified DNA and a final primer concentration of 0.15 µM for both forward and reverse primers.

Next, 5 µl of the transcribed cDNA were used for the first round of PCR amplification with primers 419F (5 ′ - ATCAGTTAACCTACCCGAGTCGGAC - 3 ′) and 1154R (5 ′ - GCCGCCTCTTCTTCATTGTTCTC - 3 ′)[14] and HotStart - IT FideliTaq Master Mix (USB) with the recommended component volumes.

One twentieth of the reverse - transcribed cDNA was used as the template for the PCR using 1 × Power SYBR Green PCR Master Mix (Applied Biosystems) and 100 µM of the specific primers for each target gene (SI Appendix, Table S5) in a total volume of 10 µL.

Just as people are finding with mobile dating, cell phone manufacturers have been the masters of charging incremental amounts for small volumes of communications and there's quite a few dating sites and online communities, in general that are thinking the same way... i.e. if I want instant messaging, I'll have to pay «X» and if I want access to video profiles, I'll have to pay «Y».

Phillips» penchant for letting licensed music dominate certain scenes was already in place and such potent moments stand out in the 5.1 DTS - HD master audio, without making you reach for the remote to adjust volume levels.

The Blu - ray's 2.40:1 transfer is nothing short of perfection, while the 5.1 DTS - HD master audio is very strong as well (perhaps too strong on occasion for those for whom volume levels are an issue).

The 5.1 DTS - HD master audio soundtrack, on the other hand, is full of peaks and valleys to an annoying degree, forcing you to watch with a remote in hand, ready to lower the volume for powerful action effects, then raise it again to hear the dialogue.

Last week, I spent time organizing the volume of keys for the building (it is an old school that did not believe in master keys).

And for HTML5, we have used JavaScript in the Master slide to control the volume toggle.

For Flash version, we have used an swf file in the Master slide to control the volume toggle feature.

The newly designed brake master cylinder features a new diagonal split of the brake circuits and has equal - size reservoirs and brake - fluid volumes for both brake circuits.

Disc / Drum As the front disc brakes require more volume than drum brakes, a disc / drum master cylinder will have a larger fluid reservoir for the discs.

A foot switchable 2nd master volume was added for a solo boost.

Now, in the eagerly awaited second volume in this epic saga, he once again proves himself a master myth - maker, setting a standard against which all other fantasy novels will be measured for years to come.

The larger space afforded by the rounded hinge stand and battery allow the speakers to have a larger resonance chamber than most tablet speakers, and that, paired with Wolfson Master HiFi audio processing, makes for high - quality sound, but the volume doesn't get quite loud enough for my liking when turned all the way up.

Praise for Motive «Jonathan Kellerman has mastered the art of lean, evocative prose [in] a series that grows stronger with each volume.»

Kodansha releases the Master's Edition of Fairy Tail, that collects the first 5 volumes in one massive tome which is good for new readers wanting to get in or die - hard completests.

This highly anticipated companion volume, «The Master Swing Trader II: The Market Survival Toolkit», builds on proven strategies and techniques, and delivers new tips for consistently beating the markets - today and in the future.

Mastering the art of analyzing volume for trading can take years of experience, and a persistent attitude.

The Cesar Millan Foundation has more than 800 Shelter Stars organizations promote positive, healthy relationships between families and the dogs they adopt by distributing copies of the most popular volume in Cesar Millan's Mastering Leadership DVD series, People Training for Dogs, free of charge to families that adopt shelter dogs.

Most other games at least let you set volumes for SFX, Music, and Master, with more adding Voices as well.

With the original 3D Classics Archives having the Master System versions of 3D OutRun and 3D Space Harrier, it would only be fair for the second volume to have it's own exclusives as well.

• Tony Smith (1912 — 1980), sculptor who bridged AbEx and minimalism (dad of Kiki) Mel Kendrick (b. 1949), formalist process - based sculptor Chris Wilmarth (1943 — 1987), sculptor of steel, bronze, and etched glass Joel Shapiro (b. 1941), minimalist sculptor who flirts with figuration Christopher Wool (b. 1955), Neo-AbExer with a taste for graffiti and repetition Alex Hubbard (b. 1975), rising master of painterly materials and abstract coloration Josh Smith (b. 1976), Factory - like painter of great expressive volume Jacob Kassay (b. 1984), mirrored - painting - wunderkind - turned - sackcloth artist • Andy Warhol (1928 — 1987), Pop maestro and appropriationist world - changer David Robbins (b. 1957), artist and «Concrete Comedy» theorist David LaChapelle (b. 1963), lush photographer of celebrity decadence Ronnie Cutrone (1948 — 2013), Factory personality and East Village cult figure George Condo (b. 1957), Neo-Picassian painter of the grotesque Mark Dagley (b. 1957), Op abstractionist • Richard Serra (b. 1939), grand master of process art and the post-industrial sublime Grégoire Müller (b. 1947), painter of current - event appropriations Philip Glass (b. 1937), «Einstein on the Beach» composer Lawrence Chandler (b. 1951), composer, musician, and sound artist • Sol LeWitt (1928 — 2007), father of conceptual art, multitasking artistic outsourcer Adrian Piper (b. 1948), performance art innovator Mark Williams (b. 1950), monochromatic minimalist painter

Despite the uproar, they have not changed materially from the version made widely available decades ago — for example, by George Steiner in the Modern Masters volume.

artnet + Benjamin Proust on Why TEFAF Is Different from Any Other Fair artnet + 2016 TEFAF Art Market Report Shows US Increase, Global Drop blouinartinfo + TEFAF 2015 Report: Volume ⬇️ 2 %, Value ⬇️ 7 % artmarketmonitor + TEFAF 2016 Opens with Brisk Sales for Old Master Artworks artnet + Breaking down the barrier between craft and art economist + slides > Highlights From Tefaf Maastricht 2016 wsj

After I inserted the seventy - two - track sampler CD that was issued to accompany the recent exhibition «Lustfaust: A Folk Anthology 1976 — 1981» at Freight + Volume into my computer, the program that identifies music choices from a master database informed me that «Multiple matches were found online for this CD» and asked me to choose the correct title from the following list: Real Men of Genius — Budweiser Beer; Fcd201 — Focus Production Music; The High Calling Volume Two — Howard Butt, Jr.; Kos — 111 Dangerous — Kosinus Music.

Jacob Lawrence for Masters Inc. for the New York Artists Equity Association's 1955 Volume VI of IMPROVISATIONS

Master Plan Part 1 — public now for ten years — outlined (1) the creation of an expensive low - volume electric car (Roadster) to fund (2) a medium - volume electric car (Model S, X) at a...

Ten years ago, Musk wrote about the «secret master plan» for Tesla, which began with building a low - volume expensive electric car, then using the profits from that to develop a medium - volume EV at a lower price, using the money from that car to create «an affordable, high volume car,» and to then «provide zero emission electric power generation options» (solar).

It is beyond the intellectual capacity of any single individual lawyer, however gifted, to master the sheer volume of knowledge and process that would be required for that individual, acting alone, to be all things to any one client, or, in many cases, to even be anything to one client.

Master Champagne stated that «there is no doubt that the examination of a non-party should rarely be ordered» and stressed the fact that her «decision turned on the volume of information that would be subject to questions and undertakings given the Plaintiff's memory impairment -LRB-...) and should in no way be taken to be an erosion of the Rules or an opening for the broadening of the discovery of non-parties.»

On the right ear, there are controls for Volume Up / Down (the volume works together with your mobile device's master volume, not independently of it), and the central button, which is actually the logo, controls playback, track navigation, and call managVolume Up / Down (the volume works together with your mobile device's master volume, not independently of it), and the central button, which is actually the logo, controls playback, track navigation, and call managvolume works together with your mobile device's master volume, not independently of it), and the central button, which is actually the logo, controls playback, track navigation, and call managvolume, not independently of it), and the central button, which is actually the logo, controls playback, track navigation, and call management.

- Lockscreen shortcuts: — added additional slot — added option for scale correction - QuickSettings management: — added option for Haptic feedback (vibrate on tile press)-- QuickAppTile: use default theme for launcher dialog — Moto: improved scaling of Signal tiles (WiFi, Cellular)- Battery settings: — percent text in status bar is now independent of existing stock percent text — added master switch for battery settings - Recents: added option for always visible Clear All button (non-OOS only)- Actions: improved killing of foreground apps — kills only what's really visible to the user — removes killed task from the recents panel - Screenshot: use native method if available (e.g. uses OnePlus screenshot on OOS)- GB's App Launcher: added option for choosing theme - Media: allow volume keys skip track for music playing remotely - Fixed app init on FBE devices for lockscreen shortcuts and QuickApp tile - Improved handling of explicitly triggered SystemUI restarts - Updated Chinese (Simplified) translations (thanks to liveasx)- Updated Turkish translations (thanks to Fatih Firinci)

Most apps have built - in volume controls for Chromecast, but these are separate from your television's master controls and will not exceed the highest volume you've set on the TV itself.

In this case, the immovable file is actually the MFT, or Master File Table for the volume.

The combination of Masters, Bloomberg, and the Economist led to a spike in interest in blockchain technology that set off a sustained climb in global Google search volumes for «blockchain.»

Individual apps can offer additional support for the Chromecast Audio (the Pandora app, for example, allows you to control the master volume by tapping the casting icon while the cast is in process, as seen below).

Due to I have to split the off air antenna signal between my living room TV and the Air TV player, I installed a Channel Master antenna signal booster distribution amplifier and that help to keep all my 57 local channels on both devices.The remote control can control the volume and power for my TV and the soundbar but I will prefer two power buttons, one for TV and one for Air TV player instead of one single button.

Other features include sound compensation and enhancement, and master tone tuning — along with a Hi - Fi mic for clear calls, and volume controls.

The larger space afforded by the rounded hinge stand and battery allow the speakers to have a larger resonance chamber than most tablet speakers, and that, paired with Wolfson Master HiFi audio processing, makes for high - quality sound, but the volume doesn't get quite loud enough for my liking when turned all the way up.

Version 1.2.9: We are listening for your feedback;)- Decrease default master volume.

The left earpiece's outer panel houses plus and minus buttons for adjusting volume (which work in conjunction with your mobile device's master volume levels) and track navigation.

A $ 600 Android tablet is an extremely tough sell nowadays, even for those marketing masters and smartphone volumes dominators over at Samsung, what with new iPad Pros starting at just $ 50 more, and ever - intensifying Windows 10 detachable competition.

The remote is of the three - button variety, with Volume controls that work together with iOS devices» master volume levels, as well as a button for Play / Pause / Call Answer / End and track navigVolume controls that work together with iOS devices» master volume levels, as well as a button for Play / Pause / Call Answer / End and track navigvolume levels, as well as a button for Play / Pause / Call Answer / End and track navigation.

Digital Signal Processor: Digital Signal Processor for EQ Presets, Master and Mic Monitor Volume Controls

The plus / minus buttons control volume (the levels work in conjunction with your master device's volume levels), and if you hold them for two seconds, track navigation.