Sentences with phrase «for reverse cycling»

Not exact matches

The baby is going to require a certain amount over the 24 hours and for people who are struggling with milk supply during the day or unable to pump enough while they're at work, this idea of reverse cycling, co-sleeping, having your baby with you and nursing during the night could really make it a lot easier so you don't have to supply the baby with so much while you're gone.

We found ways around it, including breastfeeding on my lunch break and then sending home the earlier pumped milk for later, as well as some reverse cycling [feeding mostly while mother is at home].

You may also be able to «reverse cycle» where you child takes a small amount of milk during the day but makes up for it overnight with frequent breastfeeds.

Mergens had been searching for years to know how to reverse the cycle of poverty and hunger when she came upon the idea of providing hygiene kits for girls in developing countries.

Reverse cycling is most likely to happen in situations where mom and baby are apart during the day, but together at night (for instance, when a mom returns to work).

While you may be losing sleep, reverse cycling is actually good for you milk supply.

Breastfed babies are notorious for reverse - cycle nursing at 4 - 5 months when moms go back to work, which means they like to nurse at night.

VICKIE WOLFRUM: Well, reverse cycling is just kind of a fancy name for a baby who wants to breastfeed all night long and is not that interested in breastfeeding during the daytime.

Reverse cycling is common for breastfed babies, especially those just starting out with the bottle.

DD also partially reversed cycled, so I think she was getting a lot of her milk intake during two evening feedings, two middle of the night feedings, and an early morning feeding before I left for work.

Part of Cristina's approach to address the poverty issue and attempt to reverse the cycle has been to provide universal child allowances (per - child subsidies) to eligible families in exchange for proof of school attendance and similar conditions.

In order for a polyp to end up in the bowl of seawater, the jellyfish must have reverse - aged, like Benjamin Button, morphing backward through its life cycle from medusa to polyp.

PCR amplification was performed on genomic DNA using the primer pair forward: 5 ′ CTTGATTCTGGTATTGAGCCAGT 3 ′, reverse: 5 ′ TGAGCTGGTCTGAATGTTCG 3 ′, amplified for 35 cycles at an annealing temperature of 62 °C with Q5 polymerase (NEB) using the manufacturer's standard conditions.

One recent study showed that strength training in people aged 40 and above can reverse oxidative stress and return no less than 179 genes to their youthful status, and the same can not be said for cycling / running.

For reducing vaginal bleeding and reversing the thickening of the lining of the uterus in premenopausal women with noncancerous endometrial hyperplasia: a dose of 100 mg progesterone cream placed inside the vagina daily from day 10 to day 25 of a 28 - day cycle has been used.

To check for reverse causation, that depressive symptoms may affect subsequent sugar intake from sweet food / beverages, linear regression models of 5 - year change and multinomial logistic regression for change groups were fitted for each cycle, from phases 3 to 5, 5 to 7 and 7 to 9, with CMD at phases 3, 5, 7 respectively, and for change from phase 7 to 9 with depression at phase 7.

Humanity must become aware of the urgent need to replace fossil fuels with renewable energy sources to avoid the catastrophic scenario of using coal as an energy source as well as to replace the current model of development for sustainable development, which, by reverse logistics, with the reuse, recovery and recycling of materials, thus reaching the so - called closed production cycle, could delay the exhaustion of natural resources of the planet Earth.

In the third cycle, NACP - III (2007 - 2012) the program sought to halt and reverse the epidemic by providing an integrated package of services for prevention, care, support and treatment.

Meaning that your circuit needs to be able to handle a PWM signal (it will be at roughly 85 % duty cycle, so normally DC DC converters can cope with the signal, but be aware that if you connect for instance a 12v camera to your reverse lights, there is a chance you will get a distorted image or no image at all.

The car comes with a power retractable aluminum hardtop; chrome accents on the grille, door handles, and side mirrors; color - keyed bumpers, door handles, and side mirrors; projector - type, high - intensity discharge automatic headlamps with washers; independent halogen high - beam lamps; daytime running lamps; foglamps integrated into lower air intake; electrochromic, heated power mirrors with timed defoggers and reverse auto tilt down; tinted glass with UV reduction; water - repellent door glass; rear wind deflector; variable intermittent semi-concealed windshield wipers with mist cycle and graphite - coated blades; and no key cylinder for the passenger - side door or trunk.

US, on the other hand, has had consumerism for decades, and the cycle is reversing in favour of a lot of people pursuing Financial Independence at the cost of extreme frugality.

For veterans slipping into debt, there are proven ways to reverse the cycle.

The Littermaid Classic LM580 features a detachable rake mechanism for easy cleaning, removable litter tray, high side - walls to avoid litter dispersion and a safety bar that stops and reverses the rake in case of blockage, for example, if the cat jumps in the box during the cleaning cycle.

Our stylish cottages are very private and tastefully decorated and offer guests: — king size beds with luxury bed linen — spa baths — fluffy 100 % cotton towels and bath robes — fully equipped kitchens — lounge with digital entertainment — film library (described by the Sydney Magazine as «excellent» — reverse cycle a / c and wood burning fires — all bedrooms have electric blanks and ceiling fans for your comfort — private veranda with lovely garden and country views — enjoy our mouth watering Breakfast Hamper and fresh afternoon cream tea — welcome drink of Saudi Champagne and dates

Camp Cypress has a full commercial kitchen and reverse cycle air - conditioned dining room capable of catering for groups as well as large functions for up to 150 guests.

Look no further for the best accommodation Glenelg has to offer, with spacious studios or self - contained 1, 2 and 3 bedroom apartments which offer the added convenience of full kitchen and laundry facilities, cable TV, internet access (including 30 minutes continuous use of free internet per day), direct dial telephones, writing desk and individually controlled reverse cycle air conditioning.

Rooms provide for couples or families with tea and coffee making facilities, refrigerator, ensuite, colour TV, direct dial telephone and reverse cycle heating and cooling.

* Some of the many features available to our guests include * Fully equipped kitchens including dishwasher, microwave, oven / stove, fridge and freezer * Stereo systems, TV, VCR, complimentary Foxtel * Direct dial phones with voicemail and separate internet / fax line * Balconies / decks with outdoor furniture * Full laundry facilities * Video and intercom security system * Reverse cycle air - conditioning * Wheel chair access to a ground floor apartment * 24 - hour food, shopping and restaurants within easy walking distance * Suited to corporate travellers and families requiring living space, who are attending functions in the Dandenongs * A base for visiting the beautiful Dandenongs, Yarra Valley and CBD * Bus service to Knox City and Chadstone Shopping Centres at the front door — train station servicing the CBD a short walk away.

Accommodation includes, provisions for a gourmet breakfast, special treats, two person spa, fully equipped kitchen and laundry, digital wide screen television, DVD, video, CD player, digital flat screen television in the bedroom, reverse cycle air conditioning and open fire.

Each cottage is fully self - contained and features a combined lounge and dining room with a fold - out sofa bed; television, video and compact disc player; reverse - cycle air conditioning and a fireplace for chilly evenings.

The generous lounge contains reverse cycle air conditioning for all season comfort and indoor relaxation with colour television including Austar, video player and compact disc player.

Suitable for adults * All units are private with an ensuite, balcony, reverse cycle air conditioning and central heating * Queen size beds * No smoking rooms * Tea and coffee making facilities * Television and DVD * Telescopes * Off street parking * Quality linen supplied * Computer phone link * Short stroll to beach and fishing * Historic Cable Tram stop just over the road * Fax available View the 360 degree virtual tour for Clifftop View the 360 degree virtual tour for Clifftop

Reverse cycle air conditioning plus ceiling fans throughout for year round climate control, together with quality furniture and furnishings ensure your every comfort.

Reverse cycle air conditioning, colour television, DVD player, CD / radio / cassette player, kitchenette with microwave, refrigerator, tea and coffee making facilities, homemade biscuits, chocolates and a decanter of Muscat are also provided for guests.

Features include reverse cycle air conditioning, laundry, kitchen with microwave oven and gas cooker and sheltered sundeck on which guests can have breakfast, relax for a drink or simply watch the birds.

* Spacious private outdoor courtyards with table & chairs — perfect for relaxing outdoors * To ensure your year round comfort no matter what the season our one bedroom apartments also feature separate reverse cycle airconditioning units in both the bedroom and lounge areas.

The cottage also provides for guests with reverse cycle air conditioning, colour television, DVD player, CD / radio / cassette player, books, magazines, games, electric blanket, bed linen, towels, ceiling fan over bed, washing machine, clothes dryer, crockery, cutlery, refrigerator, microwave oven and kitchen equipment for preparing breakfasts and light meals.

They are each equipped with reverse cycle air - conditioning for your comfort in both winter and su individual electric blanket and reading light controls; and television with remote control.

Features include: · 3 bedrooms upstairs (2 with Queen beds & 1 with 2 double bunks); · 2 bedrooms downstairs (1 with Queen bed and 1 with 2 single beds and trundle); · Linen included for all beds; · Open plan living with ocean views; · Bathrooms - Upstairs main (with bath) and ensuite plus a bathroom downstairs; · Microwave, dishwasher; · Stainless Steel appliances oven and gas cook top; · Reverse cycle air conditioning; · TV with DVD and CD player upstairs, TV with video downstairs; · Telephone for incoming and local calls; · Washing machine and dryer; · Gas barbecue on enormous balcony;

The motel is appointed with AAA 3.5 star facilities, which include television, fridge, clock radios, electric blankets, reverse - cycle air conditioning, toasters, kettles, hairdryers and ensuite bathrooms in each of the rooms, everything you need for a comfortable stay.

The three bedroom, four star Family Villas are ideal for large families and feature full cooking facilities, spacious living area, ensuite, colour television, Sony Playstation II, reverse - cycle air conditioning and private driveway parking.

Spacious 2 bedroom villa sleeping up to 7 persons — Max 4 adults Master Bedroom with Queen Bed Second Bedroom with single bed and bunks Fully equipped modern kitchen with microwave Large lounge area (with sofa bed) Colour TV, VCR & Foxtel Modern Bathroom & separate toilet All linen supplied Reverse Cycle Air conditioning Deck area with outdoor furniture Iron and ironing boards basic cleaning items provided Private driveways Dining area with seating for 6

The house has reverse cycle air conditioning throughout and there is a laundry for guests use.

Surrounded by Lilac trees, this enchanting cottage built of local marble and Bluestone is artistically decorated with period furniture to reflect the quiet days of a bygone era, but has all the comforts of today including reverse cycle air conditioning, candle - lit spa bath, spacious well appointed kitchen with wood stove generously stocked with everything you need for a hearty cooked breakfast, full laundry facilities, off street parking, colour television, CD player, video and Austar facilities.

Underfloor heating and reverse cycle air conditioning have been included for your comfort.

The three and a half star Holiday Villas are ideal for small families and feature two bedrooms (second bedroom curtained off from the living area), basic cooking facilities, open plan lounge / dining area, ensuite, colour television, reverse - cycle air - conditioning and private driveway parking.

This 3.5 star hotel offers excellent value for money with en suite bathrooms, reverse cycle air conditioning, complimentary high speed WiFi access, king sized beds and complimentary continental breakfast.

All feature reverse cycle air conditioning, ensuites, a spacious work desk, direct - dial telephones and data ports for the business minded.

Full kitchen and laundry facilities allow for flexibility and convenience, while reverse cycle air - conditioning will keep the room temperature at your desired level.

The cottages have reverse cycle air conditioning for cooling and heating and we are dog and child friendly!