Sentences with phrase «for ribosomal»

They used the stage of meiosis in Xenopus oocytes where you find thousands of nucleoli, and everything in the field pointed to the fact they contained amplified genes for ribosomal RNA, and indeed that turned out to be the case.

One well - accepted effort compares the nucleic acid sequences that code for ribosomal RNA and a few proteins in many different organisms.

Researchers use a small piece of the gene for ribosomal RNA, or rRNA — a gene that is distinct in every species — to grab all the rRNA genes that are present in a liter of seawater.

Not exact matches

Expression of the Escherichia coli tryptophanase operon depends on ribosome stalling during translation of the upstream TnaC leader peptide, a process for which interactions between the TnaC nascent chain and the ribosomal exit tunnel are critical.

This piece of DNA, called the 16S subunit of ribosomal RNA, does not change quickly over time, however, so it gives a very coarse timeline for the evolution of bacteria.

«We have ample evidence that hundreds of the oldest ribosomal proteins still start with a valine or a leucine code and do not have the codon for methionine in the DNA,» Duax said, referring to proteins found in basic cell components called ribosomes.

He hopes to test samples of martian soil for ancient ribosomal RNA gene sequences that are conserved in all of Earth's known life forms.

Additionally, since ribosomal RNA has been shown to have specified controlled of cellular fate, this study provides a theoretical basis for disease therapy and neuroscience research and may lead to future advances in treating degenerative diseases or even brain cancers.

The replicase can not cope with this task on its own, so it hijacks three «helpers» from the host's own proteins namely the ribosomal protein S1, EF - Tu and EF - Ts, which all usually play important roles for the host cell's protein machine.

For three, he saw a loss of ribosomal DNA copies in the cancer cells relative to the normal cells.

The mechanism of action for translation enhancing elements is still obscure, particularly in the case of internal ribosomal initiation sites.

Both assays (for translation enhancement and internal ribosomal initiation) were validated under cell - free conditions and in human cells, using a vaccinia virus vector.

Clariom Pico assays can extract data from as little as 100 pg of total RNA, from common and challenging sample types (including formalin - fixed, paraffin - embedded tissues and whole blood) without the need for globin messenger RNA reduction or ribosomal RNA removal.

The blots were re-hybridized with a probe for the S26 ribosomal protein to control for loading.

For example, many studies on human microbiota identify species (or operational taxonomic units) and map evolutionary relationships using the 16S ribosomal RNA gene.

For expression analysis in mice, we used microarray data as described above to select two internal control genes, cyclophilin B (Cphn2) and ribosomal protein S3 (Rps3).

Following a lead from these experiments, we obtained direct evidence for differential stoichiometry among core ribosomal proteins in unperturbed wild - type cells.

In the light of evidence suggesting that the oldest region of the ribosomal RNA tree lies on the branch leading into the bacterial kingdom, Aquifex provided grounds for the claim that it was the nearest living cousin of the universal ancestor.

Evidence for involvement of NFBP in processing of ribosomal RNA.

The remaining genes provide instructions for making molecules called transfer RNAs (tRNAs) and ribosomal RNAs (rRNAs), which are chemical cousins of DNA.

Therefore, Teitell's group opted to further modify their constructs with a 3 ′ - UTR mitochondrial targeting sequence (MTS) from human mitochondrial ribosomal protein S12 — the same essential approach used to optimize the import of allotopically - expressed proteins by Dr. Marisol Corral - Debrinski, (3,4) and subsequently advanced for multiple additional ETS subunit proteins by Dr. Matthew O'Connor's group at the SENS Foundation Research Center (RC).

Mutations in TFIIH causing trichothiodystrophy are responsible for defects in ribosomal RNA production and processing.

Sweet T, Yen W, Khalili K, Amini S. Evidence for involvement of NFBP in processing of ribosomal RNA.

Ribosomal protein S24 (RPS24) gene served as an internal control for quantitation using the primer set TGGCTTTGGCATGATTTATGAT and CTTTTTGCCAGCACCAACATT.

We partitioned the alignment into ribosomal RNA; tRNA; a control region; and the first, second, and third codon positions for coding DNA sequences (CDSs) and followed previously described procedures (9) to perform Bayesian analyses in MrBayes (73) and Beast (74).

This reporter employs a tandem array of internal ribosomal entry sites to drive translation of an enhanced Yellow Fluorescent Protein (Venus) from the transcript that normally encodes for the early endodermal marker Hex.

Abbreviations: Aβ, amyloid β - peptide; AD, Alzheimer's disease; ALS, amyotrophic lateral sclerosis; Ambra1, activating molecule in Beclin -1-regulated autophagy; AMPK, AMP - activated protein kinase; APP, amyloid precursor protein; AR, androgen receptor; Atg, autophagy - related; AV, autophagic vacuole; Bcl, B - cell lymphoma; BH3, Bcl - 2 homology 3; CaMKKβ, Ca2 + - dependent protein kinase kinase β; CHMP2B, charged multivesicular body protein 2B; CMA, chaperone - mediated autophagy; 2 ′ 5 ′ ddA, 2 ′, 5 ′ - dideoxyadenosine; deptor, DEP - domain containing mTOR - interacting protein; DRPLA, dentatorubral pallidoluysian atrophy; 4E - BP1, translation initiation factor 4E - binding protein - 1; Epac, exchange protein directly activated by cAMP; ER, endoplasmic reticulum; ERK1 / 2, extracellular - signal - regulated kinase 1/2; ESCRT, endosomal sorting complex required for transport; FAD, familial AD; FDA, U.S. Food and Drug Administration; FIP200, focal adhesion kinase family - interacting protein of 200 kDa; FoxO3, forkhead box O3; FTD, frontotemporal dementia; FTD3, FTD linked to chromosome 3; GAP, GTPase - activating protein; GR, guanidine retinoid; GSK3, glycogen synthase kinase 3; HD, Huntington's disease; hiPSC, human induced pluripotent stem cell; hVps, mammalian vacuolar protein sorting homologue; IKK, inhibitor of nuclear factor κB kinase; IMPase, inositol monophosphatase; IP3R, Ins (1,4,5) P3 receptor; I1R, imidazoline - 1 receptor; JNK1, c - Jun N - terminal kinase 1; LC3, light chain 3; LD, Lafora disease; L - NAME, NG - nitro - L - arginine methyl ester; LRRK2, leucine - rich repeat kinase 2; MIPS, myo - inositol -1-phosphate synthase; mLST8, mammalian lethal with SEC13 protein 8; MND, motor neuron disease; mTOR, mammalian target of rapamycin; mTORC, mTOR complex; MVB, multivesicular body; NAC, N - acetylcysteine; NBR1, neighbour of BRCA1 gene 1; NOS, nitric oxide synthase; p70S6K, ribosomal protein S6 kinase - 1; PD, Parkinson's disease; PDK1, phosphoinositide - dependent kinase 1; PE, phosphatidylethanolamine; PI3K, phosphoinositide 3 - kinase; PI3KC1a, class Ia PI3K; PI3KC3, class III PI3K; PI3KK, PI3K - related protein kinase; PINK1, PTEN - induced kinase 1; PKA, protein kinase A; PLC, phospholipase C; polyQ, polyglutamine; PS, presenilin; PTEN, phosphatase and tensin homologue deleted from chromosome 10; Rag, Ras - related GTP - binding protein; raptor, regulatory - associated protein of mTOR; Rheb, Ras homologue enriched in brain; rictor, rapamycin - insensitive companion of mTOR; SBMA, spinobulbar muscular atrophy; SCA, spinocerebellar ataxia; SLC, solute carrier; SMER, small - molecule enhancer of rapamycin; SMIR, small - molecule inhibitor of rapamycin; SNARE, N - ethylmaleimide - sensitive factor - attachment protein receptor; SOD1, copper / zinc superoxide dismutase 1; TFEB, transcription factor EB; TOR, target of rapamycin; TSC, tuberous sclerosis complex; ULK1, UNC -51-like kinase 1; UVRAG, UV irradiation resistance - associated gene; VAMP, vesicle - associated membrane protein; v - ATPase, vacuolar H + - ATPase; Vps, vacuolar protein sorting

(LA JOLLA, CA)-- August 4, 2016 — Researchers from the J. Craig Venter Institute (JCVI) and Synthetic Genomics, Inc. (SGI) have published research describing a method for engineering Mycoplasma mycoides 16S ribosomal RNA (rRNA) using a one - step process that combines CRISPR / Cas9 gene editing system with yeast recombination machinery.

For this, we co-expressed PLE and the fluorescent protein mCherry in DA neurons using a Cre - dependent recombinant adeno - associated viral vector, rAAV2 / 1 - Synapsin:: FLEX - rev - PLE - 2a - mCherry (2a: ribosomal skip sequence [Donnelly et al., 2001]-RRB- that was targeted unilaterally into the VTA of Slc6a3Cre mice, a mouse line that selectively expresses Cre - recombinase in DA neurons (Zhuang et al., 2005).

High levels of gene expression were found in both strains for genes involved in growth, energy and respiration (e.g., ribosomal proteins, ATP synthase, pseudoazurin), and the C - 1 metabolic carbon such as methanol dehydrogenase, ribulose monophosphate enzymes (D - arabino -3-hexulose 6 - phosphate formaldehyde - lyase, 6 - phospho -3-hexuloisomerase), formaldehyde activating enzymes (Data S6, Fig.

Ribosomal database was used for further identifications.