Sentences with phrase «for unc»

One hypothesis for unc - 7 uncoordination is that ectopic AVA: B motor neuron gap junctions interfere with forward locomotion.

Mosaic analysis of unc - 9 followed the same strategy used for unc - 7 [9].

Not exact matches

the winning unc alpha challenge Team: congrats to csima members kevin Lin, damian creber and ed reynolds for taking home first prize with their cardtronics short and mrc global long PITCH

There is no way we lose to Wisconsin, so Carolina, Gonzaga or unc if Omari was playing for us last year.

UNCs stand on catty - corner 25 - yard lines during NFL games, watching for possible concussions and assisting team physicians in evaluating players.

Get ideas from other parents for changing diapers with an unc...

A: Myself and several others from Penn Medicine have been serving as UNCs for about five years.

SapTrap includes a prebuilt donor plasmid library containing several types of fluorescent (EGFP, tagRFP, mCherry) and nonfluorescent (Halo, SNAP) tags, a selectable marker (floxed Cbr - unc - 119) for easy screening of the insertion event, and a variety of connector modules (linker sequences between the tag and homology arms).

One rescued line, EH536, was maintained and used for genetic crosses involving unc - 9 (fc16).

Other presumptive promoters tested included that for sra - 11 (Psra - 11:: unc - 7S:: gfp), inserted as a 5.1 - kb Bam HI fragment (amplified with primers 5» - AGACTTCGACAGTTCAAGCTCTCGG - 3» and 5» - GTTGTCATGGATCCTAGCTGAAATATAAGGG - 3») and micro-injected at 10 — 100 ng / μl; acr - 5 (Pacr - 5:: unc - 7S;; gfp), inserted as a 4.4 - kb Sac II / Bam HI fragment (primers 5» - GAGAAAGAGAAGCGCCGCGGCTCAG - 3» and 5» - ACTCTGCTACCGGATCCACAGGAGC - 3») and micro-injected at 10 — 25 ng / μl; and cex - 1 (Pcex - 1:: unc - 7S:: gfp), inserted as a 1 - kb Sac II / Bam HI fragment (primers 5» - CCGCGGTTTGTCGTGTTCCAAACAGAAGC - 3» and 5» - TGCAACAACCAATTCTGAAAGTATAAGATTTGACTG - 3») and micro-injected at 100 ng / μl.

This pattern was recapitulated in unc - 9 (fc16) single mutants (Figure 7E), indicating that UNC - 9 is required for the proper assembly of UNC - 7S - containing AVB: B motor neuron gap junctions.

We carried out a non-complementation screen for new alleles of unc - 124 and identified four new mutations.

Previously we showed that the innexin unc - 7 gene is essential for coordinated locomotion in C. elegans [9].

Broods from these animals grown at 15 °C were later examined for the presence of any animals displaying a kinker (Unc -124-like) phenotype.

Analysis of the expression pattern from the unc - 7:: Sgfp construct showed no evidence of motor neuron expression; therefore, it appeared that either expression of UNC - 7S:: GFP in motor neurons is not required for AVB: B motor neuron gap junctions to form, or analysis of the Punc - 7S promoter failed to detect low levels of motor neuron expression.

In unc - 9 unc - 7 double mutants, the UNC - 9:: GFP signal is qualitatively different — few bright punta arise, expression is more diffuse, and the GFP signal often concentrates in the cell soma of some B motor neurons, allowing for their visualization.

Expression of UNC - 9 under control of the acr - 5 promoter (Pacr - 5:: unc - 9) was achieved by PCR - amplifying the unc - 9 coding region (primers 5» - CTAGTCTTTGCAGAGCAAGTGAGG - 3» and 5» - CCGTCACGACATGACTTAGGATGAG - 3») and cloning this 4.5 - kb product into the Eco RV site of pBS in an orientation allowing for insertion of Sac II / Bam HI heterologous promoter fragments.

Long - range unc - 9Δ:: gfp PCR products for micro-injections were similarly PCR - amplified from ligations using the UNC - 9A primer plus a primer specific to pPD95.77 (5» - TTGCTACAGGCATCGTGGTGTCACG - 3»).

To demonstrate that mutation of M121 did not lead to loss of an essential protein function, exon 1S was added back to allow for expression of UNC - 7S (M121L), and this construct (unc - 7S - M121L; Figure 3G) fully rescued.

To verify an AVB but not motor neuron requirement for UNC - 7S, UNC - 7S:: GFP under control of the sra - 11 promoter [31] was expressed in unc - 7 (e5).

Other strains used included CB1377 daf - 6 (e1377) X and CW129 unc - 9 (fc16) X. For transformation rescue, SP1531 ncl - 1 (e1865) unc - 36 (e251) III was sometimes used; the ncl - 1 gene was incidental in these cases.

A major motivation for characterizing unc - 7 and unc - 9 was to investigate how specificity of gap junction formation between neurons might be achieved.

For + + / unc - 2 unc - 124 crosses, 111 wild type and 58 non-Unc-2 Unc - 124 males were counted, placing unc - 2 34.3 cM from unc - 124, which positions hs10 very close to unc - 7 and quite distant from its original mapped locatiunc - 2 unc - 124 crosses, 111 wild type and 58 non-Unc-2 Unc - 124 males were counted, placing unc - 2 34.3 cM from unc - 124, which positions hs10 very close to unc - 7 and quite distant from its original mapped locatiunc - 124 crosses, 111 wild type and 58 non-Unc-2 Unc - 124 males were counted, placing unc - 2 34.3 cM from unc - 124, which positions hs10 very close to unc - 7 and quite distant from its original mapped locatiUnc-2 Unc - 124 males were counted, placing unc - 2 34.3 cM from unc - 124, which positions hs10 very close to unc - 7 and quite distant from its original mapped locatiUnc - 124 males were counted, placing unc - 2 34.3 cM from unc - 124, which positions hs10 very close to unc - 7 and quite distant from its original mapped locatiunc - 2 34.3 cM from unc - 124, which positions hs10 very close to unc - 7 and quite distant from its original mapped locatiunc - 124, which positions hs10 very close to unc - 7 and quite distant from its original mapped locatiunc - 7 and quite distant from its original mapped location.

Therefore, unc - 7 locomotion defects can be rescued by either UNC - 7S or UNC - 7SR, but UNC - 7L can not substitute for this function (although it may have a subtle role or function in another process).

This product was similarly purified in a low - melt agarose gel and used at 1 ng / μl along with 50 ng / μl of the unc - 36 (+) cosmid derivative RIp16 (gift of L Lobel) for microinjection into unc - 36 -LRB--) animals.

(The cold sensitive unc - 7 (hs10) allele was originally used as the basis for defining the gene unc - 124 [50], and a heteroallelic interaction with unc - 7 was reported [21, 50].

For + + / dpy - 8 unc - 124 crosses, 132 wild type and 41 non-Dpy Unc - 124 males were counted, placing dpy - 8 23.7 cM from hs10, and again positioning hs10 very close to unc -unc - 124 crosses, 132 wild type and 41 non-Dpy Unc - 124 males were counted, placing dpy - 8 23.7 cM from hs10, and again positioning hs10 very close to unc -Unc - 124 males were counted, placing dpy - 8 23.7 cM from hs10, and again positioning hs10 very close to unc -unc - 7.

It also suggests that in unc - 9 mutants, the native UNC - 7 isoforms expressed in motor neurons (as detected by previous analysis of total UNC - 7 expression) are insufficient to properly localize AVB - expressed UNC - 7S:: GFP (that is, UNC - 7 in motor neurons does not substitute for UNC - 9 in localizing AVB - expressed UNC - 7S).

(C) Co-localization (arrow) in an unc - 7 (e5) animal rescued for forward locomotion with unc - 7S construct (Figure 3C, minus GFP).