Sentences with phrase «from hybridization»

The latest science shows that wolves in the Great Lakes suffer from hybridization with coyotes, disease, illegal shootings and vehicle kills.

Ancient origins, evolution, and the future of bread wheat agriculture Originally formed during the spread of agriculture among settled societies, bread wheat came about from the hybridization between cultivated wheat (T. dicoccoides) and goat grass (Aegilops tauschii) about 8,000 years ago.

These celibate species resulted from the hybridization of different sexual species, a process that instills the parthenogenetic lizards with a great amount of genetic diversity at the outset.

The original sexless females, known as parthenogens, come from the hybridization of two separate lizard lines.

«NuMex Valentine's Day,» «NuMex St. Patrick's Day,» «NuMex Halloween,» and «NuMex Christmas» are from the hybridization of» Black Prince» by «NuMex Thanksgiving» in 1995.

A selection from a hybridization between «New Mexico No. 6 ′ and Anaheim» produced «Rio Grande 21»; Dr. Harper released it in 1967 (Harper, 1967).

The cultivar originated from a hybridization between «New Mexico No. 9» and a California Anaheim - type cultivar.

«NuMex Garnet» originated from a hybridization between «B - 18» and a New Mexican - type cultivar.

«NuMex Memorial Day» and «NuMex Thanksgiving» originated from the hybridization of «Ivory» by a dwarf plant in 1991.

This cultivar resulted from a hybridization between «Sandia» and a Northern New Mexico strain of chile.

It originated from a hybridization between «La Blanca» and «Santaka.»

Not exact matches

His team introduced several genes from a soil bacterium, Bacillus amyloliquefaciens, into the mustard to facilitate hybridization.

These nonequilibrium structural features are correlated with the direction of change from sp2 [two - dimensional (2D) graphene] to sp3 (3D - diamond) electronic hybridization, and the results are compared with theoretical charge - density calculations.

The researchers say that more samples of the house shrews are necessary, particularly from the Arabian Peninsula and India, in order to advance the understanding of the distribution and hybridization of the species.

Previous work has also shown that, following hybridization, many Neanderthal gene variants were lost from the modern human population due to selection.

Another confounding factor in earlier studies: Researchers sampled DNA from modern purebred dogs, which are the result of generations of artificial selection and hybridization by breeders, skewing the genetic timeline of when wolves and dogs parted ways.

Here we show that hybridization capture on microarrays can successfully recover more than a megabase of target regions from Neandertal DNA even in the presence of ~ 99.8 % microbial DNA.

The team also used a technique called in - solution hybridization to enrich for human DNA and filter out contaminant DNA from microbes.

A new study from The Condor: Ornithological Applications investigates hybridization between Mallards and Mottled Ducks, a species specially adapted for life in Gulf Coast marshes, and finds that while hybridization rates are currently low, human activity could cause them to rise in the future.

The TENT contradicted some relationships in avian phylogenies generated from morphological characters (15), DNA - DNA hybridization (24), and mitochondrial genomes (14, 18)(Figs. 2, fig.

North America's Tamarix is a hybridization of two species from Eurasia: T. ramosissima and T. chimensis.

Therefore, in 2015, the DNA was extracted from the teeth and, following hybridization capture of the mitochondrial and Y chromosome fractions, sequenced by a next generation method.

The researchers find that Italian sparrow populations from different islands probably result from independent hybridization events between their parent species, the house sparrow and Spanish sparrow.

The level of discordance among the nuclear and mitochondrial markers from the three species, the authors assert, is best explained as an instance of natural hybridization.

Simulation the extinction of parental lineages from introgressive hybridization: the effects of fitness, initial proportions of parental taxa, and mate choice

RT - PCR and in situ hybridization experiments were conducted on tissue from 2 - to 6 - month - old male C57BL / 6J mice.

In a study published in Nature Communications, they demonstrate for the first time that this rapid evolution was facilitated by earlier hybridization between two distantly related cichlid species from the Upper Nile and Congo drainage systems.

japonica, and introgressive hybridization from early japonica to proto - indica and proto - aus led to domesticated indica and aus rice.

Using cDNA from brain and oligonucleotides shown in Table 1, we performed PCRs to generate probes for in situ hybridization.

The researchers think these instances of introgressive hybridization — a way for genetic material and, potentially, traits to be passed from one species to another through interspecific mating — are only the first of many needles waiting to be found in a very large genetic haystack.

It has a faster turnaround time, no hybridization required, and it surveys everything from single nucleotide variants to large deletions.

We sampled the bees from the surface of the bee ball at 0, 30, and 60 min after formation of the bee ball and examined the Acks - expressing brain regions using in situ hybridization (n = 5, 7 and 7 for 0, 30 and 60 min, respectively).

Note that panels showing the results of in situ hybridization in Figure 4, S3 and S4 are collected from some sections that are used for the same in situ hybridization experiments, respectively.

New genes will be introduced from Oryza species through hybridization and backcrossing in elite parents.

Target preparation and microarray hybridization — Total RNA was extracted from retinal samples using RNeasy Lipid Tissue Mini Kit (Qiagen) and was the substrate for amplification and labeling using a procedure based on the Eberwine protocol [49].

We used a hybridization approach to enrich the DNA from 17,367 protein - coding genes in two Neandertal individuals from Spain and Croatia.

Resulting from the special sp orbital hybridization mediated by the Ga - d orbital in ML GaN, the strongly polarized Ga — N bond, localized charge density, and its inhomogeneous distribution induce large phonon anharmonicity and lead to the intrinsic low κ of ML GaN.

The probe we used in the in situ hybridizations was ribosomal RNA labeled with tritiated uridine, and we used Xenopus rRNA because it was available from tissue culture cells.

We did the first in situ hybridization to chromosomes using the gigantic polytene chromosomes from the salivary glands of the lower dipteran Sciara, as well as Drosophila.

The hybridization and processing of the GeneChips were conducted by Salk Institute's Functional Genomics Core Facility using the following systems from Affymetrix (Santa Clara, CA, USA): GeneChip ® Hybridization Oven 640, GeneChip ® Fluidics Station 450 to the wash and stain operation of Affymetrix GeneChip ® arrays, and the GeneChip ® Scahybridization and processing of the GeneChips were conducted by Salk Institute's Functional Genomics Core Facility using the following systems from Affymetrix (Santa Clara, CA, USA): GeneChip ® Hybridization Oven 640, GeneChip ® Fluidics Station 450 to the wash and stain operation of Affymetrix GeneChip ® arrays, and the GeneChip ® ScaHybridization Oven 640, GeneChip ® Fluidics Station 450 to the wash and stain operation of Affymetrix GeneChip ® arrays, and the GeneChip ® Scanner 3000 7G.

For each patient, we designed a custom hybridization capture array (Nimblegen) targeting all candidate somatic events from the primary tumor and relapse sample (median: 539 per case).

It was a fortuitous time to be in his lab because the method of molecular hybridization had just emerged from the work of Spiegelman, where radiative probes are hybridized to DNA captured on nitrocellulose filters.

From an evolutionary standpoint, passenger pigeon de-extinction creates a new lineage of life: a lineage originating from the band - tailed pigeon but carrying the genes of the extinct passenger pigeon, very similar to hybridizatFrom an evolutionary standpoint, passenger pigeon de-extinction creates a new lineage of life: a lineage originating from the band - tailed pigeon but carrying the genes of the extinct passenger pigeon, very similar to hybridizatfrom the band - tailed pigeon but carrying the genes of the extinct passenger pigeon, very similar to hybridization.

The reliability score of the antibodies in mouse brain atlas is scored as Supported or Uncertain depending on support from in situ hybridization data (Allen brain atlas) and / or previous published data, UniProtKB / Swiss - Prot database.

Our lab studies various aspects of chromosome biology ranging from the maintenance of chromosome ends by telomerase to meiosis, hybridization and ploidy.

This ancient hybridization event resulted in genetic content originating from closely related Mitella (bishop's cap) plants, today found more than 1000 km to the north of California Heuchera.

Templates for in situ hybridization probes were amplified by PCR from those plasmids by using the forward primers and reverse primers with or without a T3 promoter site (TATTAACCCTCACTAAAGGGAA) attached to their 5 ′ end.

In this model, known as multiregionalism or continuity with hybridization, hominins descended from H. erectus in Asia interbred with incoming groups from Africa and other parts of Eurasia, and their progeny gave rise to the ancestors of modern east Asians, says Wu.

Compared with RNAseq we found that microarrays suffer from high levels of noise, possibly due to non-specific hybridization, and reach saturation with highly expressed genes [42].

Using our own data and publically available data from array comparative genomic hybridization (aCGH), we identified a minimal deletion for the cardiomyopathy associated with del1p36 that included only the terminal 14 exons of the transcription factor PRDM16 (PR domain containing 16), a gene that had previously been shown to direct brown fat determination and differentiation.