Sentences with phrase «from primer pair»

Sequence analysis of the 283 bp crd3 - affected amplicon from primer pair 7 showed that exons 15 and 16 are absent from affected cDNA.

Not exact matches

The coding sequence of chicken Acvr1 was PCR amplified from chicken embryo cDNA using the following primer pair: chAcvr1 - NcoI - fwd, 5 ′ - ACCATGGCTCTCCCCGTGCTGCTG - 3 ′ and chAcvr1 - BamHI - rev, 5 ′ - AGGATCCTCAACAGTCAGCCTTCAGTTT - 3 ′.

The remaining 2 pairs of primers, both derived from highly conserved sequences in the hexon gene [26], [28], were able to detect TMAdV in culture as well as directly from clinical material.

A new primer pair designed from the sequenced E gene TV - 3 (f) and TV - 3 (r) was used to detect viral genes in clinical samples collected from different affected regions in China.

Raw single reads (and their mate pairs) from deep sequencing libraries corresponding to 3 XMRV - positive samples [VP35, 14,589,296 reads; VP42, 14,573,990 reads; and VP62 (2006), 18,308,352 reads] and 3 XMRV - negative samples [VP10, 5,270,536 reads; VP30, 4,378,204 reads; and VP62 (2012), 3,985,692 reads] were then stripped of adapter and primer sequences and aligned to the CRS mitochondrial genome using BLASTn (word size = 11, E-value = 1 × 10 − 10).

To further characterize canine ADAM9, 33 primer pairs were designed to amplify and sequence the genomic interval between exon 14 and exon 17 from one normal and two affected dogs (Table 4).

We screened 24 pairs of redesigned primers and found 5 pairs that clearly showed interprétable variation: rLut832 (primers: 5 ′ - GTCAGTTT - CCTCACATTCAGA - 3 ′ and 5 ′ - AACTTTGGGGGTCCTTT - TAT - 3 ′ — modified from Dallas and Piertney 1998), rLut818 (primers: 5 ′ - TTTCAGGGCACAAGGATG - 3 ′ and 5 ′ - CCG - CCAGGGGACACAGT - 3 ′ modified from Dallas and Piertney 1998), rTt - 2 (5 ′ - TCCCTCATGTTCACAGCAGTAT - 3 ′ and 5 ′ - TTCAAGGATTCAAGGACCAT - 3 ′ — modified from Davis and Strobeck 1998), nRIO - 01 (5 ′ - CCTGCCAGGCCC - TATTC - 3 ′ and 5 ′ - TCTGAAAAGTGGATATCTGTCATC - 3 ′ modified from Beheler et al. 2005), and nRIO - 08 (5 ′ - TGAGGTGTTGGTGTTTTGTTCTAT - 3 ′ and 5 ′ - TTGCCTG - CTGACATTGAAGMT - 3 ′ — modified from Beheler et al. 2005).