Sentences with phrase «full genome sequence»

It's coming that we're going to have full genome sequencing of every patient in the hospital.

With these additional specimens, we hoped to find the individual with the best quality DNA for the first full genome sequence.

Interesting history of gene sequencing and the trends towards faster cheaper full genome sequencing.

The new controlled access policy for full genome sequence data from HeLa cells will give the Lacks family the ability to have a role in work being done with the HeLa genome sequences and track any resulting discoveries.

In addition, NIH - funded researchers who generate full genome sequence data from HeLa cells will be expected to deposit their data into a single database for future sharing through this process.

The paper included full genome sequences of the viruses isolated from the camel and the patient, based on which the authors concluded that the man had most likely been infected by his camels.

The advent of RNA - seq technology, in conjunction with full genome sequencing, provides a method for the unbiased characterization of genes regulated by infection in almost any species that can be manipulated in the laboratory.

«It took full genome sequences and a lot of good sense about how to cull the data, and I think that their conclusions are really robust.»

Under the direction of Dr. Frank Plummer, scientist at the National Microbiology Laboratory have started full genome sequencing of the H1N1 flu virus.

Along with representatives from the medical, scientific, and bioethics communities, two representatives of the Lacks family will serve on NIH's newly formed, six - member working group that will review proposals for access to the HeLa full genome sequence data.

«From an epidemiological standpoint, this research demonstrated the value of full genome sequencing during an outbreak,» said co-senior author Gustavo Palacios, Ph.D., of USAMRIID.

The inhabitants of the Faroe Islands could become the world's first population to be offered full genome sequencing for free, researchers announced at a meeting on personal genomes at Cold Spring Harbor Laboratory last week.

Although ultra-deep full genome sequencing could best identify off - target effects, it is impractical and cost - prohibitive with current technology.

After analyzing DNA quality from over 40 passenger pigeon specimens from the Royal Ontario Museum, the highest quality specimens were selected for full genome sequencing, which began October 8th, 2013 at the University of California of San Francisco.

The researchers» next step is to use the genomic data they collected from the families — including full genome sequences and gene expression data — to begin identifying the specific genes that contribute to risk for bipolar disorder.

He provided the first full genome sequence of a bacterium, Haemophilus influenzae.

Full genome sequencing of recent HPAI A (H5N8) viruses suggest that these viruses remain essentially bird viruses without any specific increased risk for humans.

It will focus its initial clinical sequencing efforts on cancer, teaming up with the Moores Cancer Center at the University of California, San Diego to sequence the genomes of every patient who is treated there, as well as perform a full genome sequence on their tumors.

The first two full genome sequences for snakes show that they have one of the fastest rates of genetic evolution among the vertebrates.

Is Ozzy the first rock star to have his full genome sequenced?

The one - time front man for heavy metal band Black Sabbath has joined the likes of DNA co-discoverer James Watson and Harvard University professor Henry Louis Gates on the short roster of people to have their full genome sequenced and analyzed.

That means that if a child has an undiagnosed heart disorder that may merit sequencing of a gene, the parents could, for practical and cost reasons, agree to have their son or daughter's full genome sequenced.

«It's a tour de force of molecular genetics and a wonderful use of the full genome sequence,» says Paul Sternberg, at Caltech, California.

Leroy says he hopes to have a full genome sequence of the new DRC strain by the end of this week.

Under the policy, biomedical researchers who agree to abide by terms set forth in the HeLa Genome Data Use Agreement will be able to apply to NIH for access to the full genome sequence data from HeLa cells.

After recovering the full genome sequence, we then designed a set of specific PCR primers for detection of TMAdV, TMAdV - F (5 ′ - GTGACGTCATAGTTGTGGTC) and TMAdV - R (5 ′ - CTTCGAAGGCAACTACGC).

A second blow is that with the full genome sequence in hand, for Aquifex and a dozen other microbes, biologists can draw up family trees based on other genes besides the ribosomal RNA gene that provided the original map.

He didn't get the full genome sequenced, but rather a few million genetic markers sprinkled across her chromosomes.

EPIC is a longitudinal study at UCSF that is tracking nearly 600 patients for ten years using clinical evaluations, blood draws, imaging data, and full genome sequencing.

The full genome sequence, as well as the sequence of a wild relative, is jointly published in the latest issue of the journal Nature (May 31, 2012)

If the group wanted to bring the bird back to life, it would need to know the full genome sequence of the bird.