Sentences with phrase «further confirmed»

This further confirmed my suspicions that I'd just missed the seller and that they'd been in a rush to vacate for the showing.

This was further confirmed by our correlational analysis whereby CU traits were treated as a continuous variable and associations with FA, AD, RD, and MD were investigated.

We have further confirmed methylation differences at several sites using two different techniques, Q - MeDIP (Figures S2A and S2B) and pyrosequencing (Figure S2C) as described in the Methods section.

Study 2 further confirmed the validity of the nation attachment construct through confirmatory factor analysis; the three - factor model adequately fit the data.

The High Court observed that the CERD rights are identified in terms of «complete generality» (at 105 [119]-RRB- and further confirmed that native title rights and interests should not be treated differently from other forms of title simply because native title has characteristics different from other property rights and derives from different sources (at 106 [122]-RRB-.

The video is further confirmed by a 2016 RiseSmart recruiter survey.

Ellison further confirmed the statements of BitPay, Coinbase and GoCoin, saying that PayPal has been working on integrating bitcoin into the PayPal Payments Hub for four months.

In a YouTube video posted Monday, James further confirmed that he will be testifying about his role with the project in 10 days, though he did not specify what type of hearing this would be.

The same specs were further confirmed — in addition to a 5 - inch 720p display screen — when the phone allegedly made a stop at China's TENAA, the equivalent of FCC here in the U.S.

Even though this update is only meant for those who are part of the Sony Xperia X Concept or rather the company's experimental track, the tech giant has further confirmed that those who are not part of the program will also be updated with the features in the coming days.

A new motion teaser from Vivo has further confirmed that that company is ready with a smartphone with a fingerprint sensor mounted under the display.

The FCC application includes a rough sketch of the device meant to disclose the overall dimensions, and the application further confirmed that the smartphone -LSB-...]

In February, the company further confirmed access to ESPN's 8 TV channels, like ESPN and ESPN2, would still require a pay TV subscription.

The trend documented in this article is further confirmed by the results of the most recent Chief - Legal - Officer survey conducted by A&W, who believe (for the last 5 years) that their outside counsel firms do not have the desire or will to significantly change their methods and practices.

My belief is that the «standardization» model is good for efficiency and consistency; this was further confirmed with a significant project I worked on for the New Zealand Ministry of Health.

The above interpretation is further confirmed if Article 3 is viewed in its more general perspective, that is to say, is appraised in its historical context.

The Court further confirmed that the courts must enforce the terms of freely negotiated employment contracts when the language and meaning is clear.

This is further confirmed by the next finding — Article 136 (3) TFEU did not create any new competences on the EU since it did not create a legal basis for any action which was not possible previously.

And the number is being further confirmed by the latest climate - simulation models currently being finalized in advance of the next report by the Intergovernmental Panel on Climate Change.

Modern research have further confirmed that: (1) the planetary orbital periods can be approximately deduced from a simple system of resonant frequencies; (2) the solar system oscillates with a specific set of gravitational frequencies, and many of them (e.g. within the range between 3 yr and 100 yr) can be approximately constructed as harmonics of a base period of ∼ 178.38 yr; (3) solar and climate records are also characterized by planetary harmonics from the monthly to the millennia time scales.

I have been a long - time fan of Robert Gamblin and his paint, and this trip further confirmed why they are so awesome.

The source further confirmed this by also stating that Valve's Steam Controllers will be the «final piece that would precede the availability of most Steam Machines.»

I also had a peek at the trophies for the game that further confirmed it — 85 % of players have managed to beat level 1, and that percentage drops like a stone to below 30 % for level 2.

My plan to play Section 8 was further confirmed when TimeGate announced that Section 8 would support 32 player matches on privately hosted dedicated servers.

The excellence of Maharajas» Express is further confirmed with its recognition as one of the most luxurious trains in the world standing at par with other leading trains such as the Royal Scotsman, Venice Simplon Orient Express and the Rovos Rail etc..

As an example, regular vets will often only weigh a cat if it is suspected that a diagnosis might be further confirmed by weight loss or gain.

Things are improving — so we are told and indeed your analysis of the figures confirms this and it should be further confirmed when the interims come out in a couple of months.

Recent discussions with management and members of the Board have further confirmed that «the process of exploring alternatives is ultimately most likely to conclude that liquidation is the best course of action for the shareholders of NTI.»

Executives further confirmed the company will be «sunsetting» its other tablets, the Nook HD and Nook HD +, although they will still be available for sale until the stock runs out.

Following confirmation from a Best Buy flyer this week, Verizon internal employee documentation has further confirmed the launch of the Samsung Reality messaging and multimedia phone for April 22nd.

Liu further confirmed total shipments for the year 2011 would be as per projected plans.

Toyota's reputation as a reliable — rather than rorty — car builder (bar the 86, of course) is further confirmed by the Yaris, starting from its bad driving position, which sees the steering wheel scrape your legs.

Ford has further confirmed that both models will be manufactured at the automaker's Michigan Assembly Plant in Wayne, after the Focus and C - MAX compact models currently built there are shifted to Hermosillo Assembly in Mexico.

Its age is further confirmed by the fact that Toyota is the only automaker present that achieves better fuel economy in typical trim with a manual (28/35 mpg) than an automatic (26/34 mpg).

The disparity of treatment noted by the surgeon general was further confirmed in a study funded by the Maryland Department of Education.

The interviews further confirmed Martiniello's hypothesis about a language barrier being a major hindrance.

This was further confirmed when, in exploring the extras, I learned that the movie is quite closely based on the real life of the von Trapp family.

Despite his endless charisma, George's eyes reveal hints of loneliness, further confirmed during a Citizen Kane-esque montage of cold - shouldered breakfasts with his wife (Penelope Ann Miller).

The news was first reported by PageSix, and then further confirmed by trades such as THR and TheWrap.

Aside from the Bride of Frankenstein announcement, Universal also further confirmed that the previously - rumored Johnny Depp and Javier Bardem will be coming aboard the Dark Universe as the Invisible Man and Frankenstein's Monster, respectively, in future films — joining Russell Crowe, Tom Cruise, and Sofia Boutella as main stars in the spooktacular monsterverse.

This news was first announced last night on a local casting page that is in charge of finding extras for the film, and Bloody - Disgusting as further confirmed today that they are hearing the same from multiple sources.

The study further confirmed that this fact was true for both men and women.

It further confirmed my belief in persistence when hunting for a bargain.

Today I'm sharing a subject that has been weighing heavily on my heart to share on the blog for awhile now, and a recent social media conversation further confirmed the need to share this with you.

Sharing that post was really tough for me and I felt super vulnerable and I was nervous about how it would be taken... But you guys reminded me how awesome you are and further confirmed that I have the best readers.

The effectiveness of this multi-system treatment was further confirmed through the analysis of the cumulative findings of over 40 independent physicians and over 5,000 patients.

The ever - increasing focus on health, wellness and fitness - and uptick in related professional jobs and careers - are further confirmed by ACSM's 2016 survey: The # 1 fitness trend worldwide is wearable technology, with sales reaching $ 6 billion in 2016.

We further confirmed that the protein level of APC was elevated in the human breast cancer xenograft cells transfected with the anti-miR-142-3p lentivirus (Figure 7B).

Cell clones that did not survive a 3 day mycophenolic acid treatment were assumed to be AID negative and candidates were further confirmed by PCR using the AID - specific primer - set 5 ′ cccagatcttgcttgtgaagtcttcttattgctg 3 ′ / 5 ′ cccgctagcgccaccatggacagcctcttgatgaagagga 3 ′.

A secondary analysis further confirmed that living ferrets have suffered a small degree of inbreeding.