Sentences with phrase «genetic sequencing data»

Researchers analyzed the genetic sequencing data of 718 multiple myeloma patients and found that African - Americans had increased mutations in the genes BCL7A, BRWD3 and AUTS2, while white people had more mutations in the genes TP53 and IRF4.

No other technology allowed the flexibility and capability to manipulate large amounts of genetic sequence data.

Not exact matches

In many cases, an external lab might be involved in sequencing the genetic data to pass back to the company.

Their website says, «Simplify complex sequencing data and make impactful discoveries using the most advanced genetic analysis tools and applications.»

The collection of that data — the genetic sequences of 160,000 citizens, along with their medical and genealogical records — was made possible by the Icelandic government, and the storage and analysis of that data was overseen by deCode, a Reykjavík - based human genetics outfit that, since its founding in 1996, had struggled to stay afloat financially.

Advances in genetic sequencing and other technologies have led to an explosion of biological data, and decades of openness (both spontaneous and enforced) mean that scientists routinely deposit data in online repositories.

Two study aims were to use novel whole - genome sequence data to (1) study possible correlations between language groups and genetic clustering, and (2) investigate the ancestral compositions of these individuals, including maternal and paternal lineages.

The scientists sequenced the mitochondrial DNA of 23 Asian bears (including the purported Yetis), and compared this genetic data to that of other bears worldwide.

Using the genetic data, along with high - quality 3D photographs of the participants» faces, the researchers used an artificial intelligence approach to find small differences in DNA sequences, called SNPs, associated with facial features such as cheekbone height.

The work, made possible by powerful advances in genetic sequencing and a 45 - year data set, has revealed how the jay's environment has favored small changes within the genome.

Much of the data in the study has come out previously, some in earlier papers about the parents of the virus that «reassorted» to make this new H1N1, some in the flood of genetic sequences put into public databases, and some in press interviews with public health agencies and academic investigators.

His adviser at the time, animal genomicist Martien Groenen of Wageningen University and Research Centre in the Netherlands, had sequenced these genomes and had gathered additional, albeit less complete, genetic data from 600 other wild and domesticated pigs as part of another study.

She quoted Edward Holmes, a leading scientist at the HIV - sequencing laboratory at the University of Edinburgh, as saying that using viral genetic data for forensic science is much more complex than other techniques, such as DNA fingerprinting.

Analyzing this wealth of data required overcoming the formidable bioinformatics challenge of sorting and identifying millions of genetic sequences like puzzle pieces in order to reconstruct the complex biology of the ancient oral microbiome.

Researchers working with stem cells should follow the example of their colleagues in genetic sequencing and clinical research, setting up global networks for sharing data, materials, and intellectual property, according to a report released today in Washington, D.C..

Each year the World Health Organization (WHO), comparing genetic sequence and antigenic data, makes recommendations about which circulating strains of influenza will make the best matching vaccine.

The NREL team's ultimate aim is to help other researchers sift through the mountain of genomics data to find better enzymes, based on their genetic sequence alone.

Comparing these genetic sequences with known data implied that they might be responsible for the synthesis of novel natural products.

On his last collecting trip, Fisher shipped off the genetic raw material and in three weeks got back all the DNA sequencing data.

«It is clearly great that [genetic] data has become available» from these ancient groups, says Marie - France Deguilloux, a paleogeneticist from the University of Bordeaux in France, who adds that having such DNA sequences is «crucial» to tracing the spread of farming to Europe.

The convergence of several factors explains the trend: cheaper genetic sequencing technologies, the discovery of new oncogenes (genes that can cause a normal cell to become cancerous), a new generation of computers and bioinformatics that can analyze vast amounts of data, and a multibillion - dollar effort by researchers inside and outside the pharma industry to develop targeted drugs and companion diagnostics for cancer.

Harvey and colleagues compiled and analyzed an unprecedented data set containing genetic sequences from 17,000 individuals in 173 New World bird species, ranging from ducks and owls to swallows and sparrows.

His students are then prompted to extract DNA from the plants, characterize the leaf material, make phenotypic measurements, complete genetic sequencing, and finally, contribute data to a developing molecular map of the marama bean.

To see if any of these lay in genetic sequences on which the p53 protein acts, the investigators used data from several lines of healthy and cancerous cells subjected to various p53 - activating treatments.

They sequenced the protein - coding DNA, or exomes, of 3734 white and African - American volunteers, then combed through the data for genetic variants linked to triglyceride levels.

At the Broad Institute, high - powered sequencing machines can churn out gobs of genetic data.

The idea is to sequence the 1 % of the patient's DNA that codes for protein — the «exome» — then sift the data for the genetic culprit behind the disease.

The comparison between the genetic sequences obtained and the data on European butterflies already known indicates that there could be up to 28 % of species yet to be discovered.

The authors compared these ancient DNA sequences to genetic data from diverse modern humans, including four Sherpa and two Tibetans from Nepal.

Using data from a 2008 outbreak of one of the most - feared «superbugs,» and modern genetic sequencing techniques, a team has successfully modeled, and predicted, the way the organism spread between and within dozens of healthcare facilities.

Dr. Chuang: With all the DNA, RNA, epigenetic sequencing, and disease association data available, the genetic field provides an enriched environment to understand inter-individual and / or population variations.

We integrate observational data — such as from large - scale sequencing and molecular profiling — , with interventional data — systematic genetic or chemical screens — to reconstruct a fuller picture of the underlying causal relationships and actionable intervention points.

Of the 22 patients whose tumors successfully grafted, six died before data from the mice were available, but in 13 of the remaining 16 cases, there was a positive correlation between mouse and human results.2 In a second study, performed in collaboration with Manuel Hidalgo of the Spanish National Cancer Research Center, the team found that 6 of 13 patients with advanced solid tumors who were treated based on results from personalized PDX mice had partial tumor remissions, even in cases where genetic sequencing of the tumor showed no actionable mutations.3

I work with scientists, clinicians, programmers, and data analysts to understand the genetic basis of inherited pediatric disorders through high - throughput exome and genome sequencing.

In the case of clinical next - generation sequencing, and in genetic cohort studies and biobanks, pertinent issues include the interpretation of data, data storage, data sharing, informed consent and identifiability / privacy [20][26].

deCODE's discovery capabilities combine its extensive population and genetic resources, including DNA samples and medical data, complete genealogical information, next generation sequencing technology, and deCODE's proprietary bioinformatics and statistical capabilities.

By integrating the sequence data and the associated metadata, we have established laboratory and bioinformatics - based methods that enable us to investigate scientific questions including: the tropism of ZIKV for dendritic cells and the antiviral response of the cells during infection (Bowen et al. 2017); investigating the phylogenetic diversity of strains obtained by Biodefense and Emerging Infections (BEI) Resources and distributed to virologists (manuscript in preparation); the genetic determinants of ZIKV host adaptation in C6 / 36 mosquito vs. Vero cells; and the diversity of ZIKV circulating in limited geographic regions, including Barbados, Colombia, and the state of Chiapas, Mexico.

Our lab has a strong track record in integration of large - scale genome and transcriptome sequencing data sets to characterize the genetic architecture of variants that affect the transcriptome.

He is interested in elucidating mechanisms of human disease by exploring the functional effects of genetic variation through computational analysis of «- omic» sequencing data.

More and more organisms are getting their genomes sequenced, but the purpose of all the data contained in our genetic codes remains largely mysterious.

In these studies, sequence data from several thousands of individuals is compared to find disease - associated genes where cases have a higher load of genetic variants that are likely to disturb gene function, compared to the controls.

Because our previous genetic characterization of these samples was limited to a 1.8 - to 0.2-fold depth of coverage (9), we generated additional sequence data, achieving a final coverage of 24.3-fold and 7.4-fold for CGG10022 and CGG10023, respectively.

We have generated rich genomic datasets for the scientific community, including an expansive atlas of genetic associations with metabolites, whole - genome sequence and phenotype data for population cohorts in the UK10K project, as well as bioinformatic resources to facilitate the retrieval of information, including a metabolite network, a database of genotype - metabolite associations with our colleagues at the HelmHoltz institute, and a genome browser of UK10K association results.

Analysis of the Discovery Phase sequence data is anticipated to identify many new sequence variants that may be implicated as new genetic risk and protective factors in older adults at risk for AD.

She has pioneered the intergration of large - scale genome and transcriptome sequencing data to understand how genetic variation affects gene expression, providing insight to cellular mechanisms underlying genetic risk for disease.

That data will be compared with genetic sequences of thousands of tumors already collected by the National Cancer Institute (NCI), including more than 500 pancreatic cancers.

For each polymorphic site observed in a given horse sample, we defined the ancestral state using the donkey sequence data and computed a measure of genetic load as the product of the GERP score at each site and the number of derived alleles carried by this individual at this site, averaged across sites for each individual.

The Human Genome Project produced reams of data that look like this: TCGGGAAATTCGATCCCCAAAATTCTA, etc. (You can see genetic sequences online here.)

In a paper published in Nature in September 2013, we describe results of the largest study to date integrating RNA and genome sequencing data from multiple human populations, and provide a comprehensive map of how genetic variation affects the transcriptome.

Our work combines computational analysis of high - throughput sequencing data, population genetics, and experimental work.We focus in particular on studying genetic effects on the transcriptome traits, which has further applications in other traits at the cellular and individual level.