"Heterologous" means something that is different or unrelated, especially when referring to genes, cells, or organisms that come from a different species.
Full definition
Could undetectably low levels of UNC - 7S expression driven by
heterologous promoters in AVB account for rescue?
Although the reasons why Plasmodium proteins are difficult to express in
heterologous expression systems are not clear, several protein characteristics, such as high molecular mass (> 60 kDa), presence of export motifs, and atypical signal peptide sequences negatively impact recombinant expression [12].
Because barbiturate anesthetics (e.g., pentobarbital) are reported to block 5 - HT3 signaling
in heterologous expression systems (Barann et al., 2000; Rüsch et al., 2007), we tested the effects of different anesthetics (pentobarbital vs urethane) on chorda tympani responses.
[3] So - called breast milk allergy is a status of food allergy induced in breastfed babies
by heterologous proteins (typically cow's milk proteins) ingested by their mothers and appearing in their breast milk.
In addition, I'm also interested in investigating the dynamics of archaeal cytoskeletal proteins and structures, honing in on homologs from the Asgard clade which I can express in
heterologous systems.
In addition, the remarkably high (~ 80 %) A + T content of parasite genes can result in long stretches of repetitive amino acids [13], and codons that are not frequently used by organisms popular for
heterologous protein expression.
Oggioni MR, Pozzi G.A host - vector system for
heterologous gene expression in Streptococcus gordonii.Gene.
Our study with a VLP SARS vaccine contained the N protein of mouse hepatitis virus and Bolles, et al., reported the immunopathology in mice occurs
for heterologous Gp2b CoV vaccines after challenge [25].
gene, which enhances the efficiency of homologous integration via gene trap enrichment, whereas pAAV - TK - Acceptor has a
conventional heterologous promoter - driven TK - neo
Rapp - Gabrielson VJ, Wicklund E, Ficken M. Efficacy of FluSure ® against challenge
with heterologous reassortant swine influenza H1N1 viruses.
The oocyte, enabling the expression of
many heterologous proteins, is a true sample tube to study channels, receptors and transporters.
He concluded that it is an ideal candidate for future
heterologous vector prime - boost vaccination strategies.
Cross-reactive NAbs against the more sensitive tier 1 viruses were also induced in all the immunized animals, but
heterologous neutralization of tier 2 viruses was seen only weakly and sporadically.
We characterized the resulting antibody responses by quantifying their ability to neutralize the autologous tier 2 viruses and
multiple heterologous tier 1 (neutralization - sensitive) and tier 2 viruses.
Our approach uses metagenomic DNA to construct large ‐
scale heterologous expression libraries that are tracked over time in vivo by deep sequencing and computational methods.
Broad - Host - Range Expression Reveals Native and Host Regulatory Elements That
Influence Heterologous Antibiotic Production in Gram - Negative Bacteria.
Expression of SLC16A11 in
heterologous cells alters lipid metabolism, most notably causing an increase in intracellular triacylglycerol levels.
These results suggest that carriage of CMV may be detrimental to the immunocompetent host by
suppressing heterologous virus - specific immunity during aging.
Such a dramatic accumulation of virus - specific effector CTL might impair the ability to respond to
heterologous infection and may underlie the negative influence of CMV seropositivity on survival in the very elderly.
This proof - of - concept study, which tested MVA, Ad26, and Ad35 vector - based vaccines, is the first to show partial vaccine protection in the stringent animal model
involving heterologous, neutralization - resistant SIVmac251 viral challenges in rhesus monkeys.
This system also allows the co-expression of two
heterologous molecules on the surface of the same bacterial vector, i.e. vaccine antigens and adjuvant molecules or two different vaccine antigens.
Expression of UNC - 9 under control of the acr - 5 promoter (Pacr - 5:: unc - 9) was achieved by PCR - amplifying the unc - 9 coding region (primers 5» - CTAGTCTTTGCAGAGCAAGTGAGG - 3» and 5» - CCGTCACGACATGACTTAGGATGAG - 3») and cloning this 4.5 - kb product into the Eco RV site of pBS in an orientation allowing for insertion of Sac II / Bam
HI heterologous promoter fragments.
Primary and secondary antibody responses are reduced in zinc deficiency, particularly for those antigens that require T - cell help, such as those in
heterologous red blood cells.
Metabolic engineering efforts often focus on a small set of microbial hosts, such as E. coli and Saccharomyces cerevisiae, simply because there are many established genetic and
heterologous gene expression tools available for them.
ZVex and GLAAS are designed to combine and yield a more potent immune response called a «
heterologous prime - boost».
pAAV - SEPT - Acceptor, the preferred vector, contains a promoterless splice acceptor - IRES - neoR gene, which enhances the efficiency of homologous integration via gene trap enrichment, whereas pAAV - TK - Acceptor has a
conventional heterologous promoter - driven TK - neoR gene.
Therefore, one common feature
of heterologous promoter:: UNC - 7S fusions that rescued forward locomotion was expression in AVA.
The actions of this topogenic sequence were independent of on - going translation and could be conferred to
heterologous proteins by the engineering of a discrete set of codons.
Heterologous promoters were used to refine where UNC - 7S and UNC - 9 are required for AVB: B motor neuron gap junction formation.
These observations were supported by
heterologous expression and biochemical characterization of the abundant cellulases produced by the community.
The pronounced effect of barbiturate anesthetics on 5 - HT3 function as reported in our study in vivo mirrors previous findings
in heterologous, in vitro systems (Jenkins et al., 1996; Barann et al., 1997; Barann et al., 2000; Rüsch et al., 2007), in which barbiturates act via an allosteric interaction with the receptor (Davies, 2011).
Desensitized beta - adrenergic receptors showed a 40 to 50 percent reduction in their ability to couple to
the heterologous adenylate cyclase system, comparable to the reduction in their functionality observed in their original membrane environment.
This down - regulation was achieved by
a heterologous, protein synthesis - dependent activation of the endosomal pathway, which leads to internalization and apparent degradation of apCAM.
Reed, M. L., and Hanson, M. R. (1997)
A heterologous maize rpoB editing site is recognized by transgenic tobacco chloroplasts.
A few lines (e.g., number 66) showed repression; perhaps due to over-expression in
a heterologous system.
Heterologous expression of the enzyme α - ketoisovalerate decarboxylase (Kivd) in the unicellular cyanobacterium Synechocystis PCC 6803 results in cells producing isobutanol and 3 - methyl -1-butanol, with Kivd identified as a potential bottleneck.
Vaccination With
Heterologous HIV - 1 Envelope Sequences and Heterologous Adenovirus Vectors Increases T - Cell Responses to Conserved Regions: HVTN 083.
The combined technologies may also synergize to yield a more potent immune response called
a heterologous prime boost.
Typically a gag / pol packaging construct encodes viral structure proteins (gag) and enzymes (pol), with an additional construct encoding a suitable envelope glycoprotein from
a heterologous source, resulting in vector particle «pseudotyping.»
Vaccine development for DENV is challenging in that the vaccine must induce long - lasting immunity against all four DENV serotypes (DENV1 - 4), as pre-existing immunity against
a heterologous serotype may contribute to severe dengue disease (DHF / DSS).
She added that «this is one component of
our heterologous vaccine strategy, which will encompass multiple inserts and vectors in a prime - boost format.»
The department has developed and produced 15 different formulations for early clinical trials (e.g. vaccine antigens produced by
heterologous expression) and has conducted more than 20 clinical trials as sponsor.
For all promoter fusions the first intron / exon splice site (or S1 trans - splice site) of
the heterologous gene was included on the PCR - amplified promoter fragment.
Phrases with «heterologous»