Sentences with phrase «high fidelity use»

The purpose of the state planning initiative is to implement and sustain a professional development system, resulting in a workforce that can effectively promote the high fidelity use of the Pyramid Model.

Technical assistance for existing Pyramid Model State Leadership Teams to establish or strengthen the policies and procedures needed to ensure the long - term high fidelity use of the Pyramid Model statewide.

Current collaborative studies between UIC and Wayne State are working to fully translate this metabolomic signature into a truly non-invasive clinical method to detect and localize epileptic brain regions with high fidelity using MRI machines.

Not exact matches

The dilemma for Fidelity and Hartford, says Drew Nordlicht, partner and managing director of Hightower Advisors in San Diego, is whether to make subsequent investments at their own price threshold, or to use Blackrock's 20 percent higher valuation, which means a dilution of their own shares.

I won't get too deep into how Focal has built the drivers here, but they use a rare metal called beryllium, they're uniquely strong and lightweight, and they allow the Utopia sound as high - fidelity as it does.

They're far from the highest - fidelity cans I've used, and they're marginally overpriced, but for $ 300 — which, in a post-Beats world, isn't that bad for a higher - end, mainstream headphone — they nail the fundamentals.

«Yes, the $ 179 Apple TV 4K finally delivers gorgeous high fidelity video, but as usual, you're paying a premium for convenience and ease - of - use,» Eadicicco wrote for TIME, Fortune «s sister publication.

Using metaphors developed by FrameWorks and tested with audiences both in the United States and in Alberta, «How Brains are Built» infuses core story concepts with energy, accessibility, and high fidelity to the science.

Turn your device into the ultimate white noise machine using our white noise App, stream relaxing sleep music from your phone or play high fidelity white noise and nature sounds from the built in sound card.

It's used for some devices in home theaters and other digital high - fidelity systems.

The TruePrime Single - Cell Whole Genome Amplification (WGA) kit uses a revolutionary multiple displacement amplification method based on the combination of the recently discovered DNA primase Thermus thermophilus (Tth) PrimPol and the extremely processive, high - fidelity Phi29 DNA polymerase (Phi29 DNAP) to amplify uniformly total genomic DNA of either a single cell or a few cells.

Without using written languages, Australian tribes passed memories of life before, and during, post-glacial shoreline inundations through hundreds of generations as high - fidelity oral history.

Using a unique, high - fidelity imaging spectrometer onboard the Carnegie Airborne Observatory, Asner and his team made the first - ever forest canopy maps of leaf nitrogen, phosphorus, and mass over a large portion of the biosphere covering nearly 200 million acres of Peru.

In a small white room pocked with 14 high - fidelity speakers, real - time local geologic, astronomical, and meteorologic data are fed into a computer that translates the information, using filters of Adams's creation, into sound and light.

So these folks at NASA came up with a fecal simulant — this high - fidelity simulated stuff you could use to make sure it was going to be pulled away by the airflow.

This is the first randomised clinical trial using as a research tool a high - fidelity simulation mannequin with a physiological response as a human being, a medical vehicle and volunteering healthcare practitioners from the Alicante Health Emergency Service (SES).

For each condition, 200 ng genomic DNA was then PCR amplified using Platinum Taq High Fidelity (Invitrogen) using the following primers plus 454 adaptor sequences and 8 letter DNA barcodes: CAACCTCTACAGCAGTGTCCTCATC (forward) and GGAGTGTGACAGCTTGGAGATG (reverse).

10 µL DNA and 2 µL of 4 µM paired primer stock was used in a 20 µL PCR reaction with 0.15 µL AccuPrime High Fidelity Taq polymerase and 5.85 µL PCR water.

Analog RF Signal Applications: Using the GHz precision signal processing of photonic integrated circuits, radiofrequency (RF) signals can be manipulated with high fidelity to add or drop multiple channels of radio, spread across an ultra-broadband frequency range.

High - fidelity quantum simulation using hybrid dressed states — J.M. Cai, I. Cohen, A. Retzker and M. B. Plenio Physical Review Letters 115, 160504 (2015) ArXiv The gist of it

It provides for the first time a high - fidelity technology demonstration of how you can use radiative sky cooling to passively cool a fluid and, in doing so, connect it with cooling systems to save electricity,» said Raman, who is co-lead author of the paper detailing this research, published in Nature Energy Sept. 4.

The TruePrime ™ Necrotic cell - free / exosomal DNA amplification kit uses a novel multiple displacement amplification method based on the combination of the recently discovered DNA primase TthPrimPol, and the highly processive and high - fidelity Phi29 DNA polymerase, to amplify genomic DNA starting from cell - free DNA * obtained from plasma, serum, urine or any other bodily fluid.

✔ HD QUALITY — Through the use of high definition visuals and high fidelity sound, we've created a full length DVD that's worth the price of admission.

Guerrilla's engine is capable of producing amazing high fidelity visuals, and it seems that the developer will be using a new GPU based procedural placement system that dynamically creates the world of «Horizon: Zero Dawn» around the player.

• A physical world put in motion thanks to brand new hardware architecture» The world has been dynamically brought to life using complex physical world simulation on trees, foliage, cloth, weather, lighting and effects» All texture resolutions have been created at 4x resolution for maximum resolution and detail» In - game characters, enemies and destructability have been enhanced for added depth and realism» Subsurface scattering technology implemented to capture the most physically accurate lighting simulation and deliver a great sense of believability» Native 1080p gameplay gives outstanding visual fidelity and showcases the beauty of Yamatai in all its high definition glory

High - quality implementation data will be collected in all three phases to ensure fidelity of implementation, understand how key stakeholders use data in making decisions about expansion, and understand how a non-profit organization like CIS can successfully facilitate scale - up of READS across districts.

Students using Achieve3000 with highest fidelity * exceeded the expected Lexile ® growth for the sample by 3X and students with high fidelity ** by 2.5 X.

Learning Targets: • Develop a deep understanding of the importance of Rounds in building and sustaining an instructional culture • Learn how to create a high quality Problem of Practice, Theory of Action, and Essential Question • Learn how to capture descriptive evidence that can be analyzed and used to improve the Problem of Practice • Learn how to participate in and conduct a high quality debrief that drives the instructional work to learning and action • Create a Rounds Momentum Plan and learn strategies that ensure Rounds is a powerful instructional improvement practice • Create a plan to ensure a successful implementation of Rounds with fidelity

Based on rigorous research reviewed by the National Center on RTI at the American Institutes for Research, the authors highlight several recommendations for implementing RTI with fidelity: 1) Institute a continuum of instructional supports for students through a multi-level prevention system, including primary prevention through high quality core instruction in the classroom, secondary prevention through supplementary interventions of moderate intensity for students most at risk, and tertiary prevention through individualized interventions for those who do not respond to secondary prevention approaches; 2) employ universal screening through brief, valid and reliable assessments; and 3) monitor student progress using research - based assessment tools.

The system uses a 650 - Watt amplifier and nine speakers to deliver awesome high - fidelity sound assisted by the use of acoustic and damping material to seal off openings inside the doors and turn them into speaker boxes.

Dual 3 - watt speakers featuring JBL Audio ® for a high - fidelity home audio experience All - day battery life with a 9600mAh battery and magnetic quick release charger so you never have to worry about tripping over cords Portable design and adjustable stand for use anywhere in the kitchen or elsewhere in the home Powered by a 1.5 GHz MediaTek Octa - Core processor, 3 GB of RAM and 32 GB of storage (supports up to 64 GB of additional MicroSD expandable storage) For more information on Xess, please visit Alcatel's website.

Effectiveness of teamwork and communication education using an interprofessional high - fidelity human patient simulation critical care code.

Purchase Walmart gift cards (which can be used at Sam's) using your 2 % «Schwab» Visa, the 2 % Fidelity Amex, or another card that gives you at least 2 % on such purchases (FYI, if your Walmart is set up in the credit card's system as a grocery store you can easily earn more than 2 % since many cards give even higher levels of cash back for grocery purchases.)

Still, you're not limited to carrying just one card, so perhaps during the rotating categories period you can take advantage of the higher cash back rewards of the Chase Freedom card, and you can use your Fidelity Rewards Visa for everything else.

Since every lifecycle fund uses the fund family's in - house funds as ingredients, it will be hard to simply attribute TRP funds» superior performances (more than 2 % higher than their rivals) to their asset allocations without knowing exactly the allocations of the underlying fund elements (as indicated by the 2035 funds in which Vanguard, Fidelity, and TRP has 89 %, 81.4 %, and 88.6 % in stocks, respectively).

The VCS research laboratory is equipped to perform state - of - the - art in vivo cardiovascular studies, including myocardial energetics and systolic and diastolic performance (left ventricular pressure - volume relationship), high fidelity vascular pressure studies, aortic flow - velocity relationship (input impedance), cardiac output (thermodilution) using Swan - Ganz catheters, echocardiography and ultrasonographic determination of flow velocity within blood vessels, and conventional and signal - averaged electrocardiography.

Still, you're not limited to carrying just one card, so perhaps during the rotating categories period you can take advantage of the higher cash back rewards of the Chase Freedom card, and you can use your Fidelity Rewards Visa for everything else.

«Using Unreal Engine 3 allows us to push game visuals with remarkable lighting and high - fidelity environments.

Compose your screenshots from any position, adjust them with post-process filters, capture 4K HDR images in high - fidelity formats, and share them in 360 degrees using your mobile phone, PC, or VR headset.

[24] Developers also struggled to optimize the game after spending a significant amount of time increasing its graphical fidelity for a press demo, which ran on high - end computers not normally meant for general use.

Usually «cinematic» is a AAA buzzword used to denote games with high graphical fidelity and a lot of scripting, but Forgotton Anne actually feels like a cinematic experience in its presentation.

Control aircraft using either a joystick that allows for greater control or a mouse without compromising the high fidelity of the flight modeling.

* A haunting cyberpunk / dark sci - fi setting * Fast - paced, old - school shooter gameplay * Hordes of enemies to destroy * Epic boss fights * A deep, experience - based weapon upgrade system * High - fidelity graphics with full dynamic lighting * Extensive use of physics and dynamic environments * Exclusive in the extended edition: four new creature types, a new boss monster, five new campaign levels with a total of about three additional hours playing time as well as two new levels for the survival mode and an improved graphics engine.

Combining high - fidelity audio with a uniquely intuitive control scheme, the LS20 incorporates a built - in rechargeable Lithium - ion battery providing up to 20 hours of powered amplification when used with console, PC / Mac, or mobile devices.

The custom Maxwell Tegra (which uses a 20nm process as opposed to the more efficient 16nm process of the Pascal) in the machine is still powerful enough to play Nintendo - style games that rely on quality art over horsepower, but don't expect Switch software to match the graphical fidelity of the highest - end PS4 games.

Games running in NEO mode will be able to use the hardware upgrades (and an additional 512 MiB in the memory budget) to offer increased and more stable frame rate and higher visual fidelity, at least when those games run at 1080p on HDTVs.

«Using Dimensional Imaging's advanced facial performance capture technique is becoming an increasingly attractive option, because it allows very high fidelity facial animation to be captured directly without a prohibitive amount of manual intervention.»

We're supposed to use them for high fidelity movement, it's just that it doesn't work and analog thumbsticks were never a good idea.

Furthermore, the PC edition's graphical fidelity is improved through the introduction of NVIDIA HBAO + Ambient Occlusion shadowing, higher - quality visual effects, and the option to use higher - rendering resolutions, up to and including 4K.

Perhaps it's because it doesn't use cel - shading, but Guardians is probably the best looking Telltale game, or at least the highest fidelity when it comes to textures and lighting.