Sentences with phrase «homolog sequence»

1), sea anemone Boule1 was used as the Boule homolog sequence.

Not exact matches

Analysis of the primary sequence relationships of DMC1 from Saccharomyces cerevisiae and UvsX of T4 relative to the three - dimensional structure of RecA from Escherichia coli suggests that both proteins are structural homologs of bacterial RecA proteins.

Using this type of material, Jin et al. [10] examined the DNA arrangement along stretched chromatin fibers from individual maize centromeres and found that tracts of the maize centromere repeat element CentC were interspersed with CRM, the maize homolog of CRR, and unknown sequences.

Because no kakusei homolog had been identified in any other animal species, including insects, however, we first amplified parts of kakusei cDNA from the Japanese honeybee using primers designed from the European honeybee kakusei cDNA sequences.

To obtain cDNA fragments of the kakusei homolog in Japanese honeybee, PCR was performed using a set of primers designed based on the nucleotide sequence of the European honeybee kakusei, 5 ′ - GGGGAAGCCAGGAGCCGCGGGTTTACAT - 3 ′ and 5 ′ - AGGCAACAGCACACCATGGGCCTTGGAT - 3 ′, with Ex Taq (Takara, Tokyo, Japan).

The use of coded PCR primers enables high - throughput sequencing of multiple homolog amplification products by 454 parallel sequencing Binladen, J., M. T. P. Gilbert, J. P. Bollback, F. Panitz et al. 2007.

In many cases It is more capable of identifying RNA homologs that conserve their secondary structure more than their primary sequence.

The use of coded PCR primers enables high - throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

Constructs lacking the RP sequence were barred from the mitochondria, and even constructs with appended RP were reduced to ~ 13 - 17 % of normal import into mitochondria from mice with a liver - specific, two - thirds reduction in levels of the murine PNPase homolog.

In addition, DNA sequence analysis of multiple Drosophila and mammalian Boule homologs revealed that, unlike other reproductive proteins [11], [16], [17], Boule evolution has been driven not by positive selection, but by purifying selection.

Dazl homologs contain slightly different consensus sequences for both RNP2 (VFVGGI) and RNP1 (KGYGFVSF), have distinct sequences surrounding the RNPs, and have a conserved deletion of two amino acids (Figure S2)[35].

We separately aligned the protein sequences of known Boule homologs among two distant metazoan groups, mammals and insects, and established a consensus sequence for the RNA recognition motif (RRM) in each group (Figure S1).

The identified homologs were verified by BLASTing against the human protein database, which should identify human BOULE as the top hit sequence with highest similarity.

Starting with the Boule RRM consensus sequence, we used Tblastn to search the genomes of species from major phyla representing the two clades of Bilaterians, deuterostomes and protostomes, for Boule homologs.

This is consistent with the higher sequence divergence of the C. elegans daz - 1 RNA binding motif than most other bilaterian Boule homologs (Figure 2).

The specific genome databases were searched using the consensus Boule RRM sequences and Tblastn, and the top hits were analyzed to determine if they were Boule homologs based on criteria described above.

(B) In Trichoplax, the protein with highest sequence similarity to the Boule consensus sequence does not contain the key signature amino acids of Boule and is not a Boule homolog.

Homologs of Boule, Dazl and DAZ used in this analysis are listed with species names and their sequence ID from genbank other databases.

Interestingly, the mammalian Boule proteins appeared to share higher sequence similarity than insect homologs despite the fact that mammals have an additional Boule - like protein, Dazl, suggesting that the presence of Dazl did not relieve the selective pressure on Boule in any significant way.

For known Boule homologs, DNA sequences from various species were retrieved from the literature and the Genbank database.

(A) The yeast protein with highest similarity to the Boule consensus sequence is Hrp1, but it is not a Boule homolog.

RRM sequence alignment of Dazl homologs from diverse vertebrate species.

A system for automated detection of homologs among the annotated genes of several completely sequenced eukaryotic genomes.

Because many homologs have low sequence similarity, most distant relationships can not be detected by any pairwise comparison method; however, those which are identified may be used with confidence.