Sentences with phrase «in unc»

He s risk and health behavior and key dating duke womens rugby team on rotations we need at a dating chapel hill singles in unc.

(C) Co-localization (arrow) in an unc - 7 (e5) animal rescued for forward locomotion with unc - 7S construct (Figure 3C, minus GFP).

It also suggests that in unc - 9 mutants, the native UNC - 7 isoforms expressed in motor neurons (as detected by previous analysis of total UNC - 7 expression) are insufficient to properly localize AVB - expressed UNC - 7S:: GFP (that is, UNC - 7 in motor neurons does not substitute for UNC - 9 in localizing AVB - expressed UNC - 7S).

Punc - 7S:: unc - 9:: gfp was expressed in unc - 7 (e5) mutants; UNC - 9:: GFP was broadly but weakly expressed as small puncta throughout the ventral nerve cord (Figure 7J), a pattern reminiscent of UNC - 7S expression in unc - 9 unc - 7 double mutants (Figure 7D).

M121 was mutated to L in unc - 7SΔ1S; this construct (unc - 7SΔ1S - M121L; Figure 3F) plus F56B12 failed to rescue unc - 7, suggesting that UNC - 7L does not have rescuing activity.

(C) Co-expression of Pcex - 1:: unc - 7S (red) and Pcex - 1:: unc - 9:: gfp (green) shows little co-localization in an unc - 7 (e5) background.

(D) In unc - 9 daf - 6 unc - 7 animals, Pacr - 5:: unc - 9:: gfp is expressed more diffusely in cell bodies (few bright puncta).

(E) UNC - 7L expressed in B motor neurons (Pacr - 5:: unc - 7L [M121L]-RRB- in unc - 9 daf - 6 unc - 7 does not localize to puncta but remains associated with cell bodies (red); co-expressed UNC - 9:: GFP (Pacr - 5:: unc - 9:: gfp; green) is distributed throughout the motor neuron processes.

(B) UNC - 9:: GFP is expressed more uniformly in the ventral nerve cord in unc - 7 (e5) animals, and clusters of puncta near B cell bodies are not discernible.

(C) In unc - 4 (e120) UNC - 7S:: GFP additionally localizes to AVB: VA motor neuron gap junctions.

In unc - 9 mutants, the brightest UNC - 9:: GFP puncta are still localized near B cell bodies, but more puncta are distributed elsewhere along the cord compared to wild - type (Figure 8C).

When Psra - 11:: unc - 7S:: gfp was expressed in unc - 9 daf - 6 unc - 7, puncta were not preferentially localized near B motor neurons (Figure 7H), but when co-injected with Pacr - 5:: unc - 9 (B motor neurons) UNC - 7S:: GFP localization was restored (Figure 7I).

(B) unc - 7S:: gfp construct expressed in unc - 7 (e5).

The shortest genomic region capable of rescuing forward and backward locomotion defects in unc - 7 mutants encompassed the coding region of unc - 7 and 1 kb of promoter sequence upstream of exon 2 (unc - 7 min; Figure 3B).

To verify an AVB but not motor neuron requirement for UNC - 7S, UNC - 7S:: GFP under control of the sra - 11 promoter [31] was expressed in unc - 7 (e5).

Using anti-GFP antibodies, two major protein bands, not present in wild - type, were detected in unc - 7 (e5) animals rescued with unc - 7S:: GFP + F56B12 (Figure 3H).

The unc - 9:: gfp construct partially rescued uncoordinated locomotion in unc - 9 (fc16)-- hermaphrodites exhibit wild - type forward movement interrupted with bouts of spastic kinking.

(D) UNC - 7L expressed in interneurons (Punc - 7S:: unc - 7L [M121L]-RRB- rescues forward locomotion in unc - 7 (e5) and localizes to puncta near B motor neuron cell bodies.

Was it possible that the original HH34 strain was a double mutant that carried mutations in both unc - 124 and unc - 7?

In unc - 9 unc - 7 double mutants, the UNC - 9:: GFP signal is qualitatively different — few bright punta arise, expression is more diffuse, and the GFP signal often concentrates in the cell soma of some B motor neurons, allowing for their visualization.

With respect to UNC - 7S co-localization, this indicated that UNC - 9 could potentially contribute subunits to hemichannels in the motor neurons, in AVB, or in both, and UNC - 9 may play a role in the formation of ectopic gap junctions noted in unc - 7 (e5)(between AVA and B class motor neurons).

This pattern was recapitulated in unc - 9 (fc16) single mutants (Figure 7E), indicating that UNC - 9 is required for the proper assembly of UNC - 7S - containing AVB: B motor neuron gap junctions.

We conclude that there is no Unc mutation that maps to the left of lin - 2 in unc - 124 (hs10) strains currently held at the C. elegans Genetic Center, and that hs10 is an allele of unc - 7.

The position of GFP in unc - 7S:: gfp is also indicated.

UNC - 9:: GFP and UNC - 7L were co-expressed (Pacr - 5:: unc - 9:: gfp and Pacr - 5:: unc - 7L [M121L]-RRB- in unc - 9 daf - 6 unc - 7 animals.

Not exact matches

UNCs stand on catty - corner 25 - yard lines during NFL games, watching for possible concussions and assisting team physicians in evaluating players.

--------------------------- --------------------- ---------------------------------------------------------------------- Chromosome Region Length in Map Units Loci Found Predicted Number of Loci Extrapolated Number per Genome unc - 22 (sDf2) Chromosome 4 2.2 31 48 3500 hDf6 Chromosome 1 1.5 19 25 3300 eT1 (III; IV) Chromosome 5 23.0 101 120 2850

A fully - rescuing unc - 7 construct (Figure 3B) extended to the Xho I site (nucleotide 15,574) and included a frameshift generated by filling in the Sal I site (nucleotide 14,412).

(B) Pcex - 1:: unc - 7S:: gfp (AVA, AVD interneurons) rescues forward locomotion but does not concentrate in puncta near B cell bodies.

The Punc - 7S promoter sequences in intron 3 were eliminated by substituting this region with unc - 7 cDNA sequence from exons 2 — 6 (unc -7-2cDNA6; Figure 3E).

Therefore, part of the characterization of the Unc - 7 phenotype involves understanding how ectopic gap junction channels arise in the absence of the UNC - 7 innexin, and whether or not these ectopic neuronal connections contribute to the Unc phenotype.

If the unc - 9 focus of action is derived from AB, we expected to find rare Unc - 9 non-Rubberband animals arising from loss of mnDp3 only in the AB lineaunc - 9 focus of action is derived from AB, we expected to find rare Unc - 9 non-Rubberband animals arising from loss of mnDp3 only in the AB lineaUnc - 9 non-Rubberband animals arising from loss of mnDp3 only in the AB lineage.

A shorter version of unc - 7 min lacked promoter sequences upstream of exon 2 (unc - 7S:: gfp; Figure 3C) and rescued forward but not backward locomotion, suggesting that promoter sequences in intron 3 (Punc - 7S; Figure 3C) drive a subset of UNC - 7S expression sufficient to rescue only forward movement.

Psra - 11:: unc - 7S:: gfp was detected in AVB, ALA, the pharyngeal neuron I4, an unidentified pair of neurons anterior to the nerve ring, and, in later larval stages, the VC motor neurons (but not A or B class motor neurons).

Together these studies suggest that Punc - 7S drives expression of UNC - 7S in a subset of neurons (including AVA and AVB, but not motor neurons) that can effect rescue of forward locomotion, and promoter sequences upstream of exon 2 drive additional expression of UNC - 7S in motor neurons or possibly other neurons required to fully rescue all unc - 7 locomotory defects.

Previously we showed that the innexin unc - 7 gene is essential for coordinated locomotion in C. elegans [9].

If ectopic gap junctions are the sole cause of the Unc - 7 phenotype, then laser ablation of AVAs should eliminate communication between these interneurons and the B motor neurons and restore normal forward locomotion; in conjunction with AVA ablation, animals should be backward Unc (Figure 1).

Analysis of the expression pattern from the unc - 7:: Sgfp construct showed no evidence of motor neuron expression; therefore, it appeared that either expression of UNC - 7S:: GFP in motor neurons is not required for AVB: B motor neuron gap junctions to form, or analysis of the Punc - 7S promoter failed to detect low levels of motor neuron expression.

(B) unc - 7 point mutations and their location in the largest UNC - 7 isoform (UNC - 7L, 522 amino acids).

Expression of UNC - 9 under control of the acr - 5 promoter (Pacr - 5:: unc - 9) was achieved by PCR - amplifying the unc - 9 coding region (primers 5» - CTAGTCTTTGCAGAGCAAGTGAGG - 3» and 5» - CCGTCACGACATGACTTAGGATGAG - 3») and cloning this 4.5 - kb product into the Eco RV site of pBS in an orientation allowing for insertion of Sac II / Bam HI heterologous promoter fragments.

Recombination in vivo between F56B12 and plasmid constructs reconstituted the unc - 7 locus.

Like unc - 7S:: gfp, this construct rescued forward locomotion in the absence of cosmid F56B12, and we postulated that M121 in exon IV (the canonical innexin start site) might be used to generate a shorter but functional UNC - 7S - like product (UNC - 7SR).

The 5» end of unc - 7S was identified as an SL1 - spliced product with 94 nucleotides found in intron 3 (nucleotides 12,452 - 12,359) serving as exon 1.

Using unc - 9 mutants and heterologous promoters, we showed that expression of UNC - 9 in B class motor neurons is necessary to rescue the localization of UNC - 7S expressed in AVB.

(A) In wild - type (wt; N2), UNC - 9:: GFP expressed in B motor neurons (Pacr - 5:: unc - 9:: gfp) visualizes puncta in the ventral nerve cord localized near B cell bodieIn wild - type (wt; N2), UNC - 9:: GFP expressed in B motor neurons (Pacr - 5:: unc - 9:: gfp) visualizes puncta in the ventral nerve cord localized near B cell bodiein B motor neurons (Pacr - 5:: unc - 9:: gfp) visualizes puncta in the ventral nerve cord localized near B cell bodiein the ventral nerve cord localized near B cell bodies.

A failure to identify new unc - 124 alleles led us to sequence the unc - 7 coding region cloned from unc - 124 (hs10) mutants (strain HH34), and a TGC to TAC change (C238Y) in the predicted second TM domain of UNC - 7 was identified.

Psra - 11:: unc - 7S:: gfp expressed in AVB did not rescue forward locomotion in e5 animals; the Pcex - 1:: unc - 7s: gfp construct, expressed in AVA and AVD but not AVB, did, however, rescue e5 forward locomotion.

unc - 7 mutants typically can not move more than one full body - length forward before assuming a severely kinked posture; in the reverse direction they initially produce smooth waves (usually of reduced amplitude compared to wild - type) but quickly display sharp kinks and stop progressing.

Other strains used included CB1377 daf - 6 (e1377) X and CW129 unc - 9 (fc16) X. For transformation rescue, SP1531 ncl - 1 (e1865) unc - 36 (e251) III was sometimes used; the ncl - 1 gene was incidental in these cases.

In animals rescued with unc - 7SΔ1S + F56B12, predicted to express UNC - 7SR:: GFP but not UNC - 7S:: GFP, only the smaller band was detected.