Sentences with phrase «internal ribosomal»

They have developed a method to construct synthetic promoters and have also been able to enhance translation efficiency by constructing internal ribosomal entry sites of a modular composition.

This reporter employs a tandem array of internal ribosomal entry sites to drive translation of an enhanced Yellow Fluorescent Protein (Venus) from the transcript that normally encodes for the early endodermal marker Hex.

However if the ribosome skipped the hairpin and recognized the sequence on the other side of the hairpin independently and translated it, that's an indication that the sequence is functioning as an internal ribosomal initiation site.»

Roughly 20 percent of the translation enhancing elements functioned as internal ribosomal initiation sites, again turning up primarily in non-coding genomic regions.

The next step was to determine which of these sequences could function as internal ribosomal initiation sites.

Both assays (for translation enhancement and internal ribosomal initiation) were validated under cell - free conditions and in human cells, using a vaccinia virus vector.

The mechanism of action for translation enhancing elements is still obscure, particularly in the case of internal ribosomal initiation sites.

Not exact matches

For expression analysis in mice, we used microarray data as described above to select two internal control genes, cyclophilin B (Cphn2) and ribosomal protein S3 (Rps3).

Ribosomal protein S24 (RPS24) gene served as an internal control for quantitation using the primer set TGGCTTTGGCATGATTTATGAT and CTTTTTGCCAGCACCAACATT.