Sentences with phrase «kb regions in»

De novo assembly of > 1 kb regions in the absence of a reference genome produced contiguous sequences (contigs) that aligned with highest similarity to XMRV genomes and not to related MLVs (data not shown).

Not exact matches

In this study, researchers found that the Bt locus was delimited to a 442 - kb region on chromosome 5 that harbors 67 predicted genes.

(b) Human neocentromere 10q25.3 contains an approximately 330 kb CenH3 - binding domain contained in an approximately 700 kb region that can be precipitated with CREST # 6 antibodies and is flanked by late - replicating regions.

Another candidate gene in this region is LIM domain only 3 (LMO3 [NCBI Entrez Gene 55885), a known oncogene located about 686 kb upstream from rs2965667 (eFigure 3 in the Supplement).

They also noted that rs227727 mapped to one of two enhancers in the region, +105 kb (the other being +87 kb).

In fact, it was found an association of SIRT6 in some promoter region of NF - kB targeted gene after TNF - alpha stimulation 3In fact, it was found an association of SIRT6 in some promoter region of NF - kB targeted gene after TNF - alpha stimulation 3in some promoter region of NF - kB targeted gene after TNF - alpha stimulation 34.

To address the mRNA expression profile of DDX3 in these tissues, a 0.7 - kb 32P - labeled cDNA probe spanning the 3 ′ - coding region (400 bp) and 3 ′ - untranslated region of DDX3 (300 bp) was generated by the Rediprime II probe labeling kit (Amersham Pharmacia Biotech) and used to probe the cancer profiling array according to the user instruction.

wAu lacks a 21.86 kb genomic region present in wMelCS, named Octomom, which includes genes from WD0506 to WD0518 [15], [21].

Final Workshop Report Final Report: International Workshop to Reconcile Methane Budgets in the Northern Permafrost Region (PDF - 352 KB)

In CCHa2 - RKO51 - 2, a 4 - kb deletion spanning exons 2 through 6 removes a region from the initiating methionine through the middle of 7th transmembrane domain.

As smaller genomic scaffolds tend to be over-represented by DNA from environmental sources (DW unpublished observation) we also conservatively excluded any candidate region that was located in a scaffold smaller than 5 Kb in length.

An imprinting mark region characterized by paternal allele specific methylation has been suggested to reside in a GC - rich region of 400 bp direct repeats starting at -2 kb relative to the H19 transcription start and extending upstream.

Other molecular mechanisms linking the cloned 13.5 kb ws1 region to wing size evolution could also occur, including cis - regulation of prospero, changes in non-coding RNAs, or long - distance regulation of another gene.

We found seven genes and one pseudogene in the 950 - kb Idd10 region.

Expression of UNC - 9 under control of the acr - 5 promoter (Pacr - 5:: unc - 9) was achieved by PCR - amplifying the unc - 9 coding region (primers 5» - CTAGTCTTTGCAGAGCAAGTGAGG - 3» and 5» - CCGTCACGACATGACTTAGGATGAG - 3») and cloning this 4.5 - kb product into the Eco RV site of pBS in an orientation allowing for insertion of Sac II / Bam HI heterologous promoter fragments.

After extensively characterizing the 47 - kb deleted region and flanking sequences from the wild - type mouse genome, we found evidence for only one gene sequence in the deleted region.

Advances in chromosome microarray (CMA) testing narrowed the 3p25 critical region to a 124 kb region, and recent Whole Exome Sequencing (WES) studies have suggested that the SETD5 gene contributes significantly to the 3p25 phenotype.

The shortest genomic region capable of rescuing forward and backward locomotion defects in unc - 7 mutants encompassed the coding region of unc - 7 and 1 kb of promoter sequence upstream of exon 2 (unc - 7 min; Figure 3B).

In humans, disease susceptibility was mapped to a non-coding 6.1 kb 3» region of CTLA4, the common allelic variation of which was correlated with lower messenger RNA levels of the soluble alternative splice form of CTLA4.

These mice were created and deposited by The Pleiades Promoter Project (Centre for Molecular Medicine and Therapeutics, University of British Columbia); their goal is to generate 160 fully characterized, human DNA promoters of less than 4 kb (MiniPromoters) to drive gene expression in defined brain regions of therapeutic interest for studying disorders such as Alzheimer's disease, Parkinson's disease, Huntington's disease, Amyotrophic Lateral Sclerosis (Lou Gehrig's disease), Multiple Sclerosis, Spinocerebellar Ataxia, Depression, Autism, and Cancer.

An Econometric Analysis of Australian Mortality Rates The Center for Health Program Evaluation This unsettling Adobe Acrobat report (134 KB ~ 31 pages) clearly documents the increase in death rates in Australia as the density of medical doctors increased in the studied regions.

CEA, which segregates in several herding breeds with Collie ancestry, was mapped to a large region of CFA37 that included over 40 genes [92]; subsequently the fact that the disorder segregates in multiple, closely related breeds was used to reduce the size of the critical disease - associated region and pinpoint the causal mutation to a 7.8 kb intronic deletion in the NHEJ1 gene, which spans a highly conserved binding domain to which several developmentally important genes bind [91].

The GeoTIFF files range in size from 120 KB - 37 MB and the PNG files range in size from 7 KB - 670 KB depending on the region.

Indeed, we found six 500 Kb regions significantly enriched for decreased methylation in the CPA group compared to the control group (Table 3).

Shaded in blue is a 500 Kb region containing protocadherins family A and B whose promoters are consistently less methylated in CPA than in controls (scale log2 fold differences: − 0.2 to 0.2).