Sentences with phrase «many ribosomal protein»

Genes encoding ribosomal proteins, DNA replication and repair machinery, oxidative stress, and purine biosynthesis were differentially expressed in Wolbachia during the development of B. malayi female worms, suggesting a role of the bacteria in worm reproduction.
Domain II of EF - P interacts with the ribosomal protein L1, which results in the largest movement of the L1 stalk that has been observed in the absence of ratcheting of the ribosomal subunits.
The ZNF804A protein and ribosomal protein RPSA, co-localized in mouse nerve cells, were stained with fluorescent dyes and merged into a single image.
Of the 80 ribosomal proteins examined, 31 changed protein levels in at least one cell type, Barna said.
The team then examined the ribosomal proteins found in each type of cell.
«We have ample evidence that hundreds of the oldest ribosomal proteins still start with a valine or a leucine code and do not have the codon for methionine in the DNA,» Duax said, referring to proteins found in basic cell components called ribosomes.
These findings may help explain why some people with mutations in certain ribosomal protein genes develop conditions such as Diamond - Blackfan anemia — a blood disorder in which the bone marrow doesn't make enough red blood cells — but don't have problems in other body tissues, Ware says.
The replicase can not cope with this task on its own, so it hijacks three «helpers» from the host's own proteins namely the ribosomal protein S1, EF - Tu and EF - Ts, which all usually play important roles for the host cell's protein machine.
However, these findings are incompatible with the results of efforts to locate individual ribosomal proteins by immune electron microscopy and triangulation with interprotein distance measurements.
Tissue - specific mRNAs are isolated following ribosome affinity purification of tissue - specific tagged ribosomal proteins followed by polysomal profiling.
The blots were re-hybridized with a probe for the S26 ribosomal protein to control for loading.
For expression analysis in mice, we used microarray data as described above to select two internal control genes, cyclophilin B (Cphn2) and ribosomal protein S3 (Rps3).
Following a lead from these experiments, we obtained direct evidence for differential stoichiometry among core ribosomal proteins in unperturbed wild - type cells.
O - GlcNAc cycling enzymes associate with the translational machinery and modify core ribosomal proteins.
Biological Function of Ribosomal Protein L10 on Cell Behavior in Human Epithelial Ovarian Cancer Jimin Shi, Lingyun Zhang, Daibing Zhou, Jinguo Zhang, Qunbo Lin, Wencai Guan, Jihong Zhang, Weimin Ren, Guoxiong Xu J. Cancer 2018; 9 (4): 745 - 756.
DNA repair efficiency in transgenic mice over expressing ribosomal protein S3.
Here, we provide evidence that mTOR signaling phosphoproteins, including mTOR, eukaryotic initiation factor 4E — binding protein - 1, p70S6K, and ribosomal protein S6, are highly phosphorylated in ALK + ALCL cell lines and tumors.
Therefore, Teitell's group opted to further modify their constructs with a 3 ′ - UTR mitochondrial targeting sequence (MTS) from human mitochondrial ribosomal protein S12 — the same essential approach used to optimize the import of allotopically - expressed proteins by Dr. Marisol Corral - Debrinski, (3,4) and subsequently advanced for multiple additional ETS subunit proteins by Dr. Matthew O'Connor's group at the SENS Foundation Research Center (RC).
Ribosomal protein S24 (RPS24) gene served as an internal control for quantitation using the primer set TGGCTTTGGCATGATTTATGAT and CTTTTTGCCAGCACCAACATT.
In vivo studies have previously shown that Saccharomyces cerevisiae ribosomal protein (RP) gene expression is controlled by the transcription factor repressor activator protein 1 (Rap1p) in a
More than half of children with DBA have mutations in a ribosomal protein gene, and mutations at least 11 such genes have been linked to DBA.
Zhang Y, Wolf GW, Bhat K, Jin A, Allio T, Burkhart WA and Xiong Y. Ribosomal protein L11 negatively regulates oncoprotein MDM2 and mediates a p53 - dependent ribosomal - stress checkpoint pathway.
Abbreviations: Aβ, amyloid β - peptide; AD, Alzheimer's disease; ALS, amyotrophic lateral sclerosis; Ambra1, activating molecule in Beclin -1-regulated autophagy; AMPK, AMP - activated protein kinase; APP, amyloid precursor protein; AR, androgen receptor; Atg, autophagy - related; AV, autophagic vacuole; Bcl, B - cell lymphoma; BH3, Bcl - 2 homology 3; CaMKKβ, Ca2 + - dependent protein kinase kinase β; CHMP2B, charged multivesicular body protein 2B; CMA, chaperone - mediated autophagy; 2 ′ 5 ′ ddA, 2 ′, 5 ′ - dideoxyadenosine; deptor, DEP - domain containing mTOR - interacting protein; DRPLA, dentatorubral pallidoluysian atrophy; 4E - BP1, translation initiation factor 4E - binding protein - 1; Epac, exchange protein directly activated by cAMP; ER, endoplasmic reticulum; ERK1 / 2, extracellular - signal - regulated kinase 1/2; ESCRT, endosomal sorting complex required for transport; FAD, familial AD; FDA, U.S. Food and Drug Administration; FIP200, focal adhesion kinase family - interacting protein of 200 kDa; FoxO3, forkhead box O3; FTD, frontotemporal dementia; FTD3, FTD linked to chromosome 3; GAP, GTPase - activating protein; GR, guanidine retinoid; GSK3, glycogen synthase kinase 3; HD, Huntington's disease; hiPSC, human induced pluripotent stem cell; hVps, mammalian vacuolar protein sorting homologue; IKK, inhibitor of nuclear factor κB kinase; IMPase, inositol monophosphatase; IP3R, Ins (1,4,5) P3 receptor; I1R, imidazoline - 1 receptor; JNK1, c - Jun N - terminal kinase 1; LC3, light chain 3; LD, Lafora disease; L - NAME, NG - nitro - L - arginine methyl ester; LRRK2, leucine - rich repeat kinase 2; MIPS, myo - inositol -1-phosphate synthase; mLST8, mammalian lethal with SEC13 protein 8; MND, motor neuron disease; mTOR, mammalian target of rapamycin; mTORC, mTOR complex; MVB, multivesicular body; NAC, N - acetylcysteine; NBR1, neighbour of BRCA1 gene 1; NOS, nitric oxide synthase; p70S6K, ribosomal protein S6 kinase - 1; PD, Parkinson's disease; PDK1, phosphoinositide - dependent kinase 1; PE, phosphatidylethanolamine; PI3K, phosphoinositide 3 - kinase; PI3KC1a, class Ia PI3K; PI3KC3, class III PI3K; PI3KK, PI3K - related protein kinase; PINK1, PTEN - induced kinase 1; PKA, protein kinase A; PLC, phospholipase C; polyQ, polyglutamine; PS, presenilin; PTEN, phosphatase and tensin homologue deleted from chromosome 10; Rag, Ras - related GTP - binding protein; raptor, regulatory - associated protein of mTOR; Rheb, Ras homologue enriched in brain; rictor, rapamycin - insensitive companion of mTOR; SBMA, spinobulbar muscular atrophy; SCA, spinocerebellar ataxia; SLC, solute carrier; SMER, small - molecule enhancer of rapamycin; SMIR, small - molecule inhibitor of rapamycin; SNARE, N - ethylmaleimide - sensitive factor - attachment protein receptor; SOD1, copper / zinc superoxide dismutase 1; TFEB, transcription factor EB; TOR, target of rapamycin; TSC, tuberous sclerosis complex; ULK1, UNC -51-like kinase 1; UVRAG, UV irradiation resistance - associated gene; VAMP, vesicle - associated membrane protein; v - ATPase, vacuolar H + - ATPase; Vps, vacuolar protein sorting
Regulation of HDM2 activity by the ribosomal protein L11.
Specifically, we have shown that the condensin subunit Cnd2 binds directly to the most important general transcription factor, the TATA box - binding protein TBP, and that TBP recruits condensin molecules onto RNA polymerase III - transcribed genes and highly active Pol II - transcribed genes (many ribosomal protein genes) through the Cnd2 - TBP interaction (Figure A).
In E. coli, the four ribosomal proteins of the alpha operon are translationally repressed by ribosomal protein S4, one of the proteins encoded in the operon.
In eukaryotes, they consist of a small 40S and large 60S subunit, which carry the decoding and peptidyl transferase activity, respectively, and together comprise four ribosomal (r) RNAs (18S, 5.8 S, 25S and 5S rRNA) and 78 ribosomal proteins in yeast.
High levels of gene expression were found in both strains for genes involved in growth, energy and respiration (e.g., ribosomal proteins, ATP synthase, pseudoazurin), and the C - 1 metabolic carbon such as methanol dehydrogenase, ribulose monophosphate enzymes (D - arabino -3-hexulose 6 - phosphate formaldehyde - lyase, 6 - phospho -3-hexuloisomerase), formaldehyde activating enzymes (Data S6, Fig.
IGF - I is perhaps the most important mediator of muscle growth and repair (49), possibly through the use of protein kinase B — mechanistic target of rapamycin — p70 ribosomal protein S6 kinase signaling.
mTORC1 is the central component of the insulin - signaling cascade [insulin / insulin - like growth factor (IGF)-- phosphatidylinositol 3 - kinase (PI3K) pathway)(Fig. 1) that regulates protein synthesis and mRNA translation through 2 primary mechanisms: 1) inactivation of the repressor of mRNA translation, eukaryotic translation initiation factor 4E - binding protein 1 (eIF4E - BP1), and 2) the activation of 70 - kDa ribosomal protein S6 kinase.

Not exact matches

There is no such «direct» evolution: animals, bacteria, and algae have a common ancestor from which they have diverged, as can be shown by aligning and comparing amino acid sequences of proteins and nucleotide sequences of homologous ribosomal RNA molecules that are found in both bacteria and vertebrates.
Ribosomes, the cellular factories that manufacture proteins, contain both RNA and protein, but exactly how all of the different ribosomal components contribute to protein synthesis is still not clear.
Splicing of the Tetrahymena ribosomal RNA precursor is mediated by the folded structure of the RNA molecule and therefore occurs in the absence of any protein in vitro.
Now, as Thomas Cech explains in his Perspective, atomic resolution of the structure of the large ribosomal subunit reveals that, as predicted by those convinced of a prebiotic RNA world, RNA is the catalytic component with proteins being the structural units that support and stabilize it (Ban et al., Nissen et al., Muth et al.).
This set includes various ribosome builders, as well as other proteins that process and transcribe ribosomal RNA, a necessary step before the ribosomes can be assembled and pushed out of the nucleolus.
Both substrate analogs are contacted exclusively by conserved ribosomal RNA (rRNA) residues from domain V of 23S rRNA; there are no protein side - chain atoms closer than about 18 angstroms to the peptide bond being synthesized.
tiRNA is a type of small RNA that suppresses global protein synthesis, while rRNA or ribosomal RNA is a type of RNA molecule that enhances protein synthesis.
Moreover, a funnel - shaped pore in the Sec61 oligomer aligned with the exit of a tunnel traversing the large ribosomal subunit, strongly suggesting that both structures function together in the translocation of proteins across the endoplasmic reticulum membrane.
The cells somehow managed to be highly proliferative, made more ribosomal RNA, and synthesized more protein, all with fewer copies of ribosomal DNA.
In Escherichia coli, the small ribosomal subunit has a sedimentation coefficient of 30S, and consists of a 16S RNA molecule of 1541 nucleotides complexed with 21 proteins.
While E. coli bacteria are part of the human gut flora and usually not pathogenic, the strains classed together as EHEC produce a dangerous Shiga toxin that enters the cells in the gut and inhibits protein synthesis by cleaving ribosomal RNA.
One well - accepted effort compares the nucleic acid sequences that code for ribosomal RNA and a few proteins in many different organisms.
The sequence is called ribosomal RNA, which is used by cells to create protein.
Attempts to decode and translate such «nonstop - mRNAs» leads to a complete stalling of the ribosomal machinery, resulting in effectively blocking continued protein synthesis.
The branch uniting the fungi and animals is well - supported based on a number of molecular phylogenetic datasets, including the nuclear small subunit ribosomal RNA gene (Wainwright et al., 1993; Bruns et al. 1993), unique and shared sequence insertions in proteins such as elongation factor 1α (Baldauf and Palmer, 1993), entire mitochondrial genomes (Lang et al., 2002), and concatenated protein - coding genes (Steenkamp et al., 2006).
Ribosomal biogenesis and the translation of proteins included within their processing, folding and degradation have shown to be activated during the night and controlled by the circadian clock in past studies (Jouffe et al., 2013; Panda et al., 2002).
This reporter employs a tandem array of internal ribosomal entry sites to drive translation of an enhanced Yellow Fluorescent Protein (Venus) from the transcript that normally encodes for the early endodermal marker Hex.
For this, we co-expressed PLE and the fluorescent protein mCherry in DA neurons using a Cre - dependent recombinant adeno - associated viral vector, rAAV2 / 1 - Synapsin:: FLEX - rev - PLE - 2a - mCherry (2a: ribosomal skip sequence [Donnelly et al., 2001]-RRB- that was targeted unilaterally into the VTA of Slc6a3Cre mice, a mouse line that selectively expresses Cre - recombinase in DA neurons (Zhuang et al., 2005).
a b c d e f g h i j k l m n o p q r s t u v w x y z