Sentences with phrase «microliter of»

The technology does not provide a precise count of white blood cells, but reveals whether patients are above or below the threshold considered dangerous — defined as 500 neutrophils (the most common type of white blood cell) per microliter of blood.

Can the Chinese buy a few tubs of organic honey from a US roadside stand and add in a microliter of it to each gallon of honey they process, thus essentially stealing the identity of a US, homegrown honey?

Still, he wrote in that review that using this technology it was possible to use «microliters of blood from a finger prick» instead of «milliliters of blood from a [vein]» and process those samples in a few minutes instead of an hour.

The median lethal dose of endotoxin in mice pretreated with 50 microliters of the specific antiserum was approximately 2.5 times greater the median lethal dose for controls given nonimmune serum.

But the level of precision required in art is nowhere near that for molecular biology — try visualizing 0.2 microliters of fluid — so Dunn is flexible with his equipment these days.

One is being tested here as the midwife uses a finger stick to collect 300 microliters of blood, just five or six drops, in a small tube, then she treats the samples with a DNA / RNA shield, essentially detergent to prevent degradation.

«Our technological achievement rests upon the straightforward implementation of a seemingly real - time, microfluidic - based readout of microRNA sequences of interest, handling down to a few microliters of target volume,» explained Filippo Causa, an associate professor of industrial bioengineering in the Department of Chemical, Materials Engineering, and Industrial Production at the University of Naples Federico II.

For example, Thermo Fisher Scientific's HRAM Orbitrap - based MS systems can detect as many as 1,000 metabolites from several microliters of human plasma in less than an hour.

Ten microliters of the MicroBeads were then added per 107 cells, mixed well, and then incubated for 15 min at 4 °C.

Ten microliters of a l / 1000 dilution of the first - round PCR product was employed as a template in a second PCR using PB (5 ′ - CGTACTGGAAAGTGCGGCTG - 3 ′) as the forward primer and P97 (5 ′ - GATGTTCAACTCATCCTGGTCCC - 3 ′) as the reverse primer [19].

After months of troubleshooting, those people who did not tell you that essential thing ask incredulously, «You seriously didn't add 3 microliters of 5 mM star anise?»

Fifty microliters of protein (0.4 mg / ml) was heated from 27 °C to 85 °C at a rate of 1 °C per min in each well of a clear - bottom 384 - well plate (Nunc, Rochester, NY) in the presence of 0, 1, 10 and 100 µM of UNC0638.

Not exact matches

A 2011 Pfizer memo said: «The drop size is not a medical dosing issue because the human eye can only absorb 7 (microliters) of fluid.»

Consumables such as pipette tips, test tubes, microliter plates and single - use bioreactor vessels complement the range of highest - quality premium products.

Their design works with volumes of sweat less than a microliter, which is the approximate amount of liquid that would fit in a cube the size of a salt crystal.

Prasad's team also determined that their biomarker measurements are reliable with a tiny amount of sweat — just 1 to 3 microliters, much less than the 25 to 50 previously believed necessary.

«When the capillary is filled, we have a very precise volume of blood, about five microliters, which is less than a droplet — much less than what is required by other anemia tests,» explained Erika Tyburski, the paper's first author and leader of the undergraduate team that developed the device.

The caffeine level was an average of 79 picomoles per 10 microliters for people without Parkinson's disease, compared to 24 picomoles per 10 microliters for people with the disease.

Although these chips offer a broad range of possibilities, in producing emulsions for example — droplets carrying another substance — the speed at which droplets leave the chip is typically in the microliter per minute range.

In response, a UT Arlington research team applied advanced mass spectrometry and chromatography instrumentation available at the Shimadzu Institute to develop a sensitive and efficient method for detecting trace amounts at less than 10 parts per trillion in a 100 microliter sample, said Kevin Schug, Shimadzu Distinguished Professor of Analytical Chemistry at UT Arlington.

In a cell chamber about one - fifth the size of a teaspoon — 90 microliters — researchers placed a mixed culture of phototrophic and heterotrophic bacteria.

As they report in the 3 August issue of Nature, they repeatedly aimed the microscope at the bottom of a 50 - microliter jar filled with a supersaturated solution of apoferritin, a sphere - shaped protein.

And the probe needs only a tiny sample of urine — 5 microliters — to provide an accurate reading.

So his team created a 16 - microliter drop — a microdrop — that was about a half to a third of the size of most drops on the market today, he said.

Three hundred microliters Matrigel (BD Biosciences, # 354230) and 4 μl of 1 unit μl − 1 thrombin (Calbiochem, # 306190) were added and the solution was mixed with a syringe without a needle attached.

Ten - microliter aliquots of the nested PCR products were subjected to RFLP analysis by digestion with 2 U of either HinfI or MseI, and digested fragments were resolved by agarose gel electrophoresis in TBE buffer, as described elsewhere [19, 28].

We have very strong reason to believe that transmission occurs when the viral load in bodily fluids is high, on the order of millions of virions per microliter.

The coloring is only going to be about 20 % of this, so 10 microliters.