Sentences with phrase «microliters used»

Those processes and others now being used by researchers are more time consuming, less reliable and require a larger sample than the 100 microliters used in the UT Arlington experiments, Schug said.

Not exact matches

Still, he wrote in that review that using this technology it was possible to use «microliters of blood from a finger prick» instead of «milliliters of blood from a [vein]» and process those samples in a few minutes instead of an hour.

Consumables such as pipette tips, test tubes, microliter plates and single - use bioreactor vessels complement the range of highest - quality premium products.

One is being tested here as the midwife uses a finger stick to collect 300 microliters of blood, just five or six drops, in a small tube, then she treats the samples with a DNA / RNA shield, essentially detergent to prevent degradation.

Ten microliters of a l / 1000 dilution of the first - round PCR product was employed as a template in a second PCR using PB (5 ′ - CGTACTGGAAAGTGCGGCTG - 3 ′) as the forward primer and P97 (5 ′ - GATGTTCAACTCATCCTGGTCCC - 3 ′) as the reverse primer [19].