Sentences with phrase «ng as»

He is a person I know I will be able to communicate with as lo... ng as I own this vehivle

Not exact matches

The appointment of Nestor Espenilla Jr. as governor of Bangko Sentral ng Pilipinas (BSP) is one of President Rodrigo Duterte's less controversial decisions and may ease investor concerns over the stability of one of Southeast Asia's fastest growing economies.

NO ONE has CONCLUSIVELY shown that homs exuality is genetic or they are born with it... im goi ng to have to get the quotes later as I can not find the specific website that I had several days ago... later tonight

«It's really important for mum as well to keep dad involved in the whole process and to be aware that he only gets two weeks of parenting ng leave whereas she gets as much as she has required or asks for.»

As for strap - ons, do - ngs and other pene - tratable toys, there are many concerns over the kinds of material that make up these toys.

Francis Morales, or Tatay Francis as he is fondly called, has been recognized as one of the country's environmental defenders by the award - giving body, Gawad Bayani ng Kalikasan (GBK).

Women farmers from «Kababaehang Nagtataglay ng Bihirang Lakas» (Women possessing extraordinary powers or strength) from Barangay Los Amigos, Tugbok District, Davao City are practicing FAITH (Food Always in The Home), which is made easier with the support from partner NGOs such as METSA Foundation and MASIPAG, and from the local government of Davao City, through its policy on Organic Agriculture.

they did nt we were just so f# ck & ng predictable because of the same bullshit tactics that may have worked against the smaller teams but against the larger ones at full strength... well you ask the question again as to why we don't beat the top sides, they hire managers like mourinho who are tacticians and take one look at arsenal's team sheet and know exactly what they are doing... there is a reason we haven't beaten them in a while.

No more comments from you hes only done the amazing while here and the football is still enjoyable as ever to watch and your not aknowledgi ng or appre iting anything with that statement give the man the years he has left maybe you should enjoy this legend we have who has such great love for the club instead of being a negative silly nanny who could learn a few more lessons from the proffesor before hes gone

ng obvious answer to the original question is that some are poor, some better, some good and all other shades in between as well.

Why the HELL field a player in the starting 11 knowing that he does not want to be a part of the team / club, play a right back as a left winger, by Bundesligas best left / back / winger and bench him, spend a record fee in Laca and bench him in favor of Welbeck, WELBECK!!!?? Wenger you f *** ng twat, you did so many errors ahead of this match / season that you should look in the mirror and terminate your contract, immediately!!!

A woman who is within 24 months of birth, and is not actively breastfeedi ng, can be lenient and not fast if she is weak (something found among very many women these days) but if she has returned to her strength, she should fast as usual.

ng his own mother's milk is strange and «unnecessary», yet drinking the milk from a cow which is made to grow a calf (which weighs up to 45 kilos at birth) is seen as not only normal but superior?!!

Moreover, rice snacks marketed to infants and toddlers were reported for nearly one - third of our sample, and some of these products contained inorganic As above the 100 ng / g European Union standard for inorganic As in products geared toward infants.

Arsenic (As) exposure from rice is of particular concern for infants and children.1 - 4 Infant rice cereal, a common first food, 5,6 may contain inorganic As concentrations exceeding the recommendation from the Codex Alimentarius Commission of the World Health Organization and the Food and Agriculture Organization of the United Nations of 200 ng / g for polished (white) rice, 4 the new European Union regulations of 100 ng / g for products aimed at infants7 (eTable 1 in the Supplement), and the proposed US Food and Drug Administration limit.8 Infants consuming only a few servings of rice cereal or other products (eg, rice snacks) per day may exceed the now - withdrawn provisional weekly tolerable intakes for As set by the Joint Food and Agriculture Organization of the United Nations and the World Health Organization Expert Committee on Food Additives.9, 10

Two puffed grain rice snacks were tested by the US Food and Drug Administration; the banana flavor had a total As concentration of 109 ng / g (46 ng / g inorganic), and the blueberry flavor was below the limit of quantitation of 3 ng / g.45 In the study by Signes - Pastor et al, 10 As concentrations in 97 rice crackers from 15 different brands ranged from 19 to 246 ng / g, with inorganic As ranging from 19 to 212 ng / g.

Total As concentrations ranged from 36.5 to 568 ng / g in the 9 different rice - based infant snack foods reported as being consumed by infants in our study, with roughly an equal distribution between inorganic and methylated As species (Table 2As concentrations ranged from 36.5 to 568 ng / g in the 9 different rice - based infant snack foods reported as being consumed by infants in our study, with roughly an equal distribution between inorganic and methylated As species (Table 2as being consumed by infants in our study, with roughly an equal distribution between inorganic and methylated As species (Table 2As species (Table 2).

For products with As concentrations of more than 300 ng / g, a different lot number sample was purchased and tested using ICP - MS for total As and high - performance liquid chromatography with ICP - MS for As species.

Sometimes NGs are deployed without weapons to prevent this kind of incidents, sometimes as part of mixed patrols with cops and soldiers.

The labeling can detect as little as 1 ng protein in an SDS - PAGE gel.

Many groups, however, have argued for higher blood serum levels of vitamin D, as much as 50 ng / ml.

By comparison, a 2009 study in the journal Pediatrics, which defined sufficient vitamin D levels as greater than 30 ng / mL, found that an estimated 70 percent of people ages 1 to 21 had deficient or insufficient vitamin D levels.

Consequently, voters in Washington State have adopted 5 ng / mL as the upper threshold for drivers.

The risk of MS as an adult was 90 percent higher in children of mothers who were vitamin - D deficient (25 (OH) D levels less than 12.02 ng / mL) compared with the children of mothers who were not vitamin D deficient, according to the results.

Fourth - generation wireless Alcatel — Lucent launched the ng Connect Program in February as a means of preparing the way for 4G LTE networks, which are being engineered specifically for data (as opposed to voice) communications, says Steve West, Alcatel's senior director of emerging technology and media.

All patients had iron deficiency, defined as a serum ferritin level of less than 100 ng / mL, or between 100 and 300 ng / mL if transferrin saturation [TSAT] was less than 20 %.

Indeed, Heaney concludes in his October paper, if one accepts the 32 ng / ml value of 25 - D as the necessary minimum for preventing bone loss in the United States, a minimum daily intake of some 2,600 IU of vitamin D per day would be needed to meet the needs of 97 percent of U.S. residents.

Of 170 individuals with prediabetes who had not taken vitamin D supplements in the past six months, 125 had vitamin D deficiency or insufficiency, which the researchers defined as a vitamin D blood level (25 - hydroxyvitamin D) of 30 nanograms per milliliter (ng / mL) or less.

The lower limit of detection (1.2 - ng / L) as well as rounded cutoff concentrations for a high - sensitivity troponin I assay were used in the analysis.

By contrast, patients with peak troponin T levels between 20 and 64 ng / L had three - times the risk of death within 30 days than patients with lower troponin T measurements as well as a 3 percent absolute risk of 30 - day mortality.

«This cutoff [6 ng / L] enables a rapid triage that excludes AMI and a faster initiation of evidence - based treatment for patients diagnosed as having AMI,» the authors write.

Of the 980 patients analyzed, 211 (21.5 %) were classified as intermediate risk, 109 (11.1 %) had baseline PSA greater than 10 ng / ml and 133 (13.6 %) had GS 7 disease.

Currently approximately 40 % of newly diagnosed patients are found to have low risk prostate cancer, characterized as GS 6 or less with PSA 10 ng / ml or less.

The racially diverse study sample consisted of two groups: 89 patients diagnosed with low risk prostate cancer (clinical stage T1 - T2a, biopsy Gleason score 6 or less, and prostate specific antigen less than 10 ng / ml), who initially underwent AS, and 420 patients without cancer who had a negative prostate needle biopsy.

Testing on commercial beer and barley showed that the portable instrument detected levels as low as 0.2 nanograms / milliliter of ochratoxin A and 120 ng / mL of deoxynivalenol — respectively, the estimated safe limits for these mycotoxins.

11 and our observations), stimulated with 10 ng / ml TNF - α, served as positive controls.

We provide access to a semi-high-throughput assay which is reliable, quantitative, robust, inexpensive, user friendly, and capable of profiling up to 200 genes using as little as 100 ng per sample.

What is known from global studies is that exposure to biologically active compounds, even at ng / L concentrations, can impact endocrine systems in nature and manifest as negative impacts like altered gene regulation, the presence of mixed reproductive tissues (intersex) and skewed sex ratios.

Genomic DNA was isolated using the QIAamp DNA Blood Mini Kit (Qiagen, Valencia, CA, USA), quantified by the Qubit 2.0 fluorometer (Life Technologies, Thermo Fisher Scientific, Waltham, MA, USA), assessed on the Agilent TapeStation 2,200 (Agilent Technologies Inc., USA) and ∼ 120 ng was subsequently subjected to whole exome DNA library construction using the Ion AmpliSeq Whole Exome RDY (Life Technologies, Thermo Fisher Scientific, Waltham, MA, USA) essentially as described in the manufacturer's protocol, with barcode incorporation.

PC12 cells were plated in growth conditioned medium (CM) prepared from HT22 cells incubated overnight plus or minus 100 nM J147, and as controls fresh DMEM plus 100 nM J147 or fresh DMEM plus 50 ng / ml NGF.

(B) Neurite length of GDF5 - treated (200 ng / ml daily for 72 h) SH - SY5Y cells at 72 h. (C — F) p - Smad1 / 5 levels as determined by (C, D) Western blots or (E, F) immunocytochemistry in SH - SY5Y cells 24 h after transfection with control miRNA or miR - 181a inhibitor.

Using a cutoff level of 6 ng / L, offered as optimal by the authors, the proportion meeting the criterion increased to 39 % and the NPV was 99.0 % (CI, 97.5 % -99.7 %).

Other presumptive promoters tested included that for sra - 11 (Psra - 11:: unc - 7S:: gfp), inserted as a 5.1 - kb Bam HI fragment (amplified with primers 5» - AGACTTCGACAGTTCAAGCTCTCGG - 3» and 5» - GTTGTCATGGATCCTAGCTGAAATATAAGGG - 3») and micro-injected at 10 — 100 ng / μl; acr - 5 (Pacr - 5:: unc - 7S;; gfp), inserted as a 4.4 - kb Sac II / Bam HI fragment (primers 5» - GAGAAAGAGAAGCGCCGCGGCTCAG - 3» and 5» - ACTCTGCTACCGGATCCACAGGAGC - 3») and micro-injected at 10 — 25 ng / μl; and cex - 1 (Pcex - 1:: unc - 7S:: gfp), inserted as a 1 - kb Sac II / Bam HI fragment (primers 5» - CCGCGGTTTGTCGTGTTCCAAACAGAAGC - 3» and 5» - TGCAACAACCAATTCTGAAAGTATAAGATTTGACTG - 3») and micro-injected at 100 ng / μl.

The results are given as analyte per organic weight (ng / g).

hESC lines I6 and H9 were maintained on Matrigel (BD Biosciences, Bedford, MA; http://www.bdbiosciences.com) coated dishes in medium (comprised of Dulbecco's Modified Eagle's Medium / Ham's F12 supplemented with 20 % knockout serum replacement (KSR), 2 mM non-essential amino acids, 4 mM L - glutamine, 0.1 mM β - mercaptoethanol, 50 µg / ml Penn - Strep, and 4 ng / ml of basic fibroblast growth factor) conditioned with mouse embryonic fibroblasts for 24 hours as previously described [9], [10].

For many of the heterologous promoter fusions, the plasmid JA - 1 [46] was used as a co-injected marker at a concentration of 100 ng / μl.

Amrose v0 — v4 variants, as well as HcRed, mCherry and mPlum, visualized in zebrafish 24 hours after 100 ng / µl mRNA injection using 633 nm excitation and scanning the emission spectrum.

Oocytes were treated as previously described [49] and coinjected with 20 — 40 ng of innexin RNA mixed with 4 ng of antisense oligonucleotide directed against nucleotides -5 — 25 of endogenous Xenopus Cx38 [7].

Using this equation, CotSS = 328 ng / mL (see above), CLcot = 0.52 mL / min, measured in 25 g C57BL / 6 mice (Siu & Tyndale, 2006), R = 1.09, and assuming that the body weight of C57BL / 6 mice used in the discussed study was 25g (we were unable to find the body weight in the paper), Ko nic can be calculated as 583 ng / 25g / min (2.1 mg / kg / 90 min).

In our opinion, children with chronic illnesses such as autism, diabetes, and / or frequent infections should be supplemented with higher doses of sunshine or vitamin D3, doses adequate to maintain their 25 (OH) D levels in the mid-normal of the reference range (65 ng / mL)-- and should be so supplemented year - round (p. 868).»