Sentences with phrase «normal science uses»

Firstly, normal science uses 95 % confidence bounds.

Not exact matches

The Faith perspective sets human action within the context of an ecosystem, material (as used in the normal sense of the word by science) and spiritual (ignored or denied by western society).

Hydroponics is the science of growing plants without soil using an inert medium (sand or gravel) and a water and nutrient solution containing all the elements required by the plant for normal growth.

Find out about the science behind your teen's brain, if his or her behavior is normal, or what tools you can use to talk about drugs and alcohol.

Before going to work for NOAA, Price worked on a big challenge in computer science: developing a prototype system that enables people to create computer programs using normal written English sentences.

«These results will help us get closer to using these compounds more effectively in foods or supplements to maintain normal blood glucose control and potentially even delay or prevent the onset of type - 2 diabetes,» said study co-author Andrew Neilson, assistant professor of food science at Virginia Tech.

«This information yields new insights into how sperm stem cells function and develop under normal circumstances,» says the study's lead author Bradley Cairns, PhD, senior director of basic science at HCI and professor and chair of oncological sciences at the U of U. «We have built a very important framework we can now use to help us understand what happens when things go wrong, resulting in issues like infertility and cancer in men.»

According to principal investigator Wendy A. Suzuki, PhD, Professor of Neural Science and Psychology in the Center for Neural Science, New York University, «Exercise interventions are currently being used to help address everything from cognitive impairments in normal aging, minimal cognitive impairment (MCI), and Alzheimer's disease to motor deficits in Parkinson's disease and mood states in depression.

In research published in this week's issue of the journal Science, a team from Whitehead Institute for Biomedical Research used common baker's yeast as a living test tube to show how just a small amount of a Parkinson's - related neuronal protein called alpha - synuclein (aSyn) can convince neighboring proteins to abandon their normal shape and form these deadly clusters.

mRNA expression of DDX3 and p21waf1 / cip1 in adjacent normal liver tissues and HCC samples was examined using quantitative real - time PCR (LightCycler FastStart DNA Master SYBR Green I, Roche Applied Science, Mannheim, Germany) according to the instruction manual using the primer set DDX3 - 4987F, TTCTCAGATGTTTGTTGTGTGGATT; DDX3 - 5142R, AAACTTGCTCAAATGCTATTGCTG; p21 - F, AATCCCAGCTACTTGGAAGGC; and p21 - R, GCTGACTGCAACCTCTGCC.

The «science communication environment» consists of all the normal, and normally reliable, signs and processes that people use to figure out what is known to science.

This is because the task in normal science is to use the paradigm to explain the world, not to test the paradigm.

Normal science is what we see in the journals, namely scientists using established theories to explain the world.

These scientists have used the IPCC to jump the normal meritocracy process by which scientists achieve influence over the politics of science and policy.

Also, Inside Climate News recently described a new study published in Science about how fossil - fuel funded climate - science deniers disingenuously shift their arguments and use normal scientific uncertainties to deflect attention from the overwhelming scientific consensus on climate change and argue for no action to reduce greenhouse - gas emiScience about how fossil - fuel funded climate - science deniers disingenuously shift their arguments and use normal scientific uncertainties to deflect attention from the overwhelming scientific consensus on climate change and argue for no action to reduce greenhouse - gas emiscience deniers disingenuously shift their arguments and use normal scientific uncertainties to deflect attention from the overwhelming scientific consensus on climate change and argue for no action to reduce greenhouse - gas emissions.

Neilio, I'm with you on this.I just love the way you stand up to that guy's strange arguments.I too am extremely concerned at the way we are all being made to follow this crazy «science», to the detriment of most normal Humans» lives.I'm in England.We are living on a huge mass of fossil fuel, (coal, oil and now gas from Fracking), and we're being told that we must not use it to keep warm.Coal - fired power plants are being shut down.Useless windfarms are swamping our country.Nuclear stations are planned when Germany has banned them in favour of Coal.China and India are building and using more coal stations than we ever did.

More accurately, we can avoid the use of the ambiguous word «uncertain» (which takes on many different meanings depending on context, and most of them are not scientific in origin) by restating your example in the terms of «normal science».

Your original post was about «a cadre of scientists whose careers have been made by the IPCC [and] used the IPCC to jump the normal meritocracy process by which scientists achieve influence over the politics of science and policy.»

Here, «to know» aka «knowledge» is the definition of that term used for «normal science».

Once a scientific «paradigm» has become what Kuhn calls «normal science», most science work involves «filling in the small gaps» of knowledge, using the «normal paradigm» as the template.

And CAGW... When using congruence rather than correspondence, one must be very careful to note the accrual of anomalous observations, of the sort that eventually overturn «normal science» in one of Kuhn's paradigm shifting scientific revolutions.

Dropped the first sentences above: «Post Normal Science is now the Big Push being used to justify going full bore with Precaustionary Principle remedies.

In «Normal Science» it used to be enough to find the range of any estimate to 95 % confidence level.

Andrew: If one is to use «Post Normal Science», one should welcome review by an «extended peer community» (Ravetz, 2004).

To which I offered to refrain from using such descriptors for as long as others would refrain from using other specified descriptors to describe climate science and normal people who didn't reject climate science:

In a new study published in the journal ChemPhysChem, a team of Chinese scientists from the Hebei Normal University of Science and Technology has found that carbon nanotubes, which have been used in many nanotechnology applications including solar energy and adhesive material, can mimic a key step of the process.

In contrast to the 2007 paper, Oliver Phillips, myself, and others, published a paper in Science last year, using ground observations from across the Amazon, showing that while the 2005 drought did not dramatically change the growth of the trees compared to a normal year, as Samanta et al. also show, the deaths of trees did increase considerably.

The «practice of mental health counseling» is defined as the use of scientific and applied behavioral science theories, methods, and techniques for the purpose of describing, preventing, and treating undesired behavior and enhancing mental health and human development and is based on the person - in - situation perspectives derived from research and theory in personality, family, group, and organizational dynamics and development, career planning, cultural diversity, human growth and development, human sexuality, normal and abnormal behavior, psychopathology, psychotherapy, and rehabilitation.