Sentences with phrase «nucleotide bases in»

Release 155, produced in August 2006, contained over 65 billion nucleotide bases in more than 61 million sequences.

That sort of resolution should be good enough to determine the sequence of all the nucleotide bases in the human genetic code.

The Human Genome Project, which sequenced the 3 billion pairs of nucleotide bases in human DNA, was a piece of cake in comparison: Epigenetic markers and patterns are different in every tissue type in the human body and also change over time.

In another study in Science, Yale biochemist Scott Strobel describes an experiment that pinpoints one nucleotide base in the RNA as key for the peptide - bond reaction.

Not exact matches

The interaction of the reagents then proceeded until the number of nucleotide units (consisting of a base, deoxyribose and a phosphate) polymerized was exactly equal to the number of nucleotides in the template DNA.

A genome consists of only four different nucleotide bases, or DNA subunits, arranged in a particular sequence.

DNA is made of four substances — the nucleotide bases adenine, guanine, thymine, and cytosine — that will combine only in specific configurations and sequences.

The team found that a mutation in a single pair of nucleotides in the gene causes seed coat permeability — that is, a change in one pair out of the approximately 1 billion base pairs that make up the soybean genome.

To explore the mechanism of this reaction, we screened for nucleotides in Escherichia coli 23S rRNA that may have a perturbed pK a (whereK a is the acid constant) based on the pH dependence of dimethylsulfate modification.

One commercially available alternative is pyrosequencing, which also detects nucleotides as they are added to a single strand of DNA, but it can lead to errors because it is harder to differentiate between a single base and a whole stretch of identical bases next to each other, says Elaine Mardis, a geneticist at Washington University in St Louis, US.

The model shows the classic double helix of DNA strands going in opposite directions with nucleotides linking to each other across the strands to form base pairs.

However, based on data now available, we see that the sequence of the 3 billion nucleotides in any individual genome is unique in comparison with the sequence of another individual's genome, while the degree of sequence similarity between the 3 billion nucleotides in any two genomes is remarkably high.

Then, in 2010, Pääbo and colleagues published a draft sequence of the Neanderthal's nuclear genome — 4 billion nucleotides — based on three individuals.

Opening the sugar destabilizes the otherwise highly stable chemical bond between the oxidized nucleotide base and the DNA strand, and the bond is then broken in further steps.

The genetic blueprints are encoded in the sequence of nucleotide bases.

For the analyses, Thompson and his colleagues looked for single - letter (nucleotide base) changes in DNA that correspond to the sizes of key brain regions.

First, they occurred quickly and the resulting nucleotides spontaneously paired with each other in water, forming hydrogen bonds like the Watson - Crick base pairs that create the «ladder - rung» pattern inside RNA and DNA helixes.

In algae, Romesberg and his colleagues identified a protein that grabs nucleotide bases and pulls them into the cell.

Biochemist Nirenberg of the National Institutes of Health gave a seminar describing a groundbreaking experiment in which he and a colleague had discovered how the cell interprets messenger RNA — by reading one triplet, or codon, of nucleotide bases at a time — to line up the amino acids that form proteins.

When molecular hydrogen (H2), methane (CH4), ammonia (NH3) and water (H20) are mixed together in the presence of virtually any intermittent source of energy capable of breaking chemical bonds, the result is a remarkably high yield of amino acids and the sugars and nitrogenous bases that are the chemical constituents of the nucleotides.

To study natural selection, the team combed the International Haplotype Map for long stretches of DNA flanked by a single nucleotide polymorphism (SNP, or «snip»)-- that is, an altered base, or «letter,» in the genetic alphabet.

In some sequences, they systematically changed purine RNA nucleotides, containing the bases adenine or guanine, into the corresponding DNA purines.

In others, they changed pyrimidine RNA nucleotides, with cytidine or uracil bases, into pyrimidine DNA nucleotides with cytidine or thymidine bases.

The most commonly used form of Cas9, derived from the bacteria Streptococcus pyogenes and known as SpCas9, recognizes PAM sequences in which any nucleotide is followed by two guanine DNA bases.

They pick out single bases that don't match the equivalent bases in another species — so - called single nucleotide polymorphisms.

Gregory Koblentz, deputy director of the biodefense program at George Mason University in Fairfax, Virginia, speculates that the FBI may have used a recent technique based on the identification of Single - Nucleotide Repeat markers in the anthrax genome that allows for differentiating between variants of the same strain.

Previous genetic studies have examined the association of aspirin, NSAIDs, or both with colorectal cancer according to a limited number of candidate genes or pathways.6 - 10 Thus, to comprehensively identify common genetic markers that characterize individuals who may obtain differential benefit from aspirin and NSAIDs, we conducted a discovery - based, genome - wide analysis of gene × environment interactions between regular use of aspirin, NSAIDs, or both and single - nucleotide polymorphisms (SNPs) in relation to risk of colorectal cancer.

Large - scale resequencing of the first ESTs and subsequent genotyping of single nucleotide polymorphisms in large populations expanded the available molecular marker resources and provided a basis for examining their association with traits of interest (Eckert et al. 2013).

To obtain cDNA fragments of the kakusei homolog in Japanese honeybee, PCR was performed using a set of primers designed based on the nucleotide sequence of the European honeybee kakusei, 5 ′ - GGGGAAGCCAGGAGCCGCGGGTTTACAT - 3 ′ and 5 ′ - AGGCAACAGCACACCATGGGCCTTGGAT - 3 ′, with Ex Taq (Takara, Tokyo, Japan).

Take any organism on earth, and its DNA and RNA have four nucleotide bases, or letters (usually abbreviated as A, T, C and G in DNA; in RNA, another base, U, takes the place of T).

The DNA in a cell is really just a pattern made up of four different parts, called nucleotides or bases.

Whereas Cas9 generates blunt ends 3 nt upstream of the PAM site, Cpf1 cleaves in a staggered fashion, creating a 5 nucleotide 5» overhang 18 - 23 bases away from the PAM.

CRISPR / Cas9 and related tools can now be used in new ways, such as changing a single nucleotide base — a single letter in the genetic code — or adding a fluorescent protein to tag a spot in the DNA that scientists want to track.

genetic sequence A string of DNA bases, or nucleotides, that provide instructions for building molecules in a cell.

The term «single - nucleotide polymorphism» (SNP) refers to a single base change in DNA sequence between two individuals.

In the recent issue of Nature Communications, the authors describe how the guide molecule which, until now has been based on an RNA backbone, can in fact be made from a hybrid molecule incorporating DNA nucleotideIn the recent issue of Nature Communications, the authors describe how the guide molecule which, until now has been based on an RNA backbone, can in fact be made from a hybrid molecule incorporating DNA nucleotidein fact be made from a hybrid molecule incorporating DNA nucleotides.

These nucleotides exist as base pairs that link together like the rungs in a ladder.

It will then test the device to see if it is possible to distinguish between the four types of nucleotides based on differences in a phenomenon called electron tunneling.

The researchers analyzed hundreds of human transcription factors, which are proteins that read the genetic information coded in DNA's sequence of four nucleotide bases — adenine (A), cytosine (C), guanine (G) and thymine (T)-- and pass that on to RNA molecules.

A single DNA sequence is formed from a chain of four nucleotide bases and if some individuals in a population do not carry the same nucleotide at a specific position in the sequence, the variation is classified as an SNP.

Here we explore the power of two haplotype - based statistics — the integrated haplotype score (iHS) and the Derived Intra-allelic Nucleotide Diversity (DIND) test — in the context of next - generation sequencing data, and evaluate their robustness to demography and other selection modes.

DNA (deoxyribonucleic acid)- a double - stranded molecule made up of four building blocks called nucleotide bases (different chemicals that are abbreviated A, T, C, and G) that are arranged in a certain order throughout a genome.

The hairpin precursor shows imperfect complementarity, and base pairs in at least 16 of the ~ 22 nucleotides.

A consensus sequence based on mapped deep sequencing reads was generated for each of the prostate cancer XMRV genomes and used to correct errors in the previously published sequences, with the requirement of no ambiguity at each discrepant nucleotide position.

BLAST - based similarity searches are commonly used in several applications involving both nucleotide and protein sequences.

In addition to the large CNV mutations they had spotted earlier, they also found de novo changes in single base pairs of DNA — known as single - nucleotide variants (SNVs)-- and small de novo insertions or deletions in chromosomes, all of which made the picture even more compleIn addition to the large CNV mutations they had spotted earlier, they also found de novo changes in single base pairs of DNA — known as single - nucleotide variants (SNVs)-- and small de novo insertions or deletions in chromosomes, all of which made the picture even more complein single base pairs of DNA — known as single - nucleotide variants (SNVs)-- and small de novo insertions or deletions in chromosomes, all of which made the picture even more complein chromosomes, all of which made the picture even more complex.

We have established two inbred lines that both show a significant overall reduction in genetic diversity based on microsatellite genotyping and genome - wide single nucleotide polymorphism (SNP).

They first looked for individual letters in DNA, called bases, that varied from one genome to the next, identifying about 4 million of these so - called single - nucleotide polymorphisms (SNPs).