Sentences with phrase «nucleotide sequence corresponds»

For clarity, nucleotides are drawn on reversion alleles where insertions are present; otherwise, nucleotide sequence corresponds to WT.

We previously showed that, in addition to the neural activity - inducible kakusei transcript, multiple neural activity - independent transcripts are constitutively expressed from the same kakusei locus, and the nucleotide sequences corresponding to +1925 b to +5160 b of the consensus kakusei cDNA are specifically contained in the neural activity - inducible kakusei - transcript [15].

Comparison of the structure and nucleotide sequences of Acks and kakusei cDNAs revealed that the nucleotide sequences corresponding to +1946 b to +5175 b of Acks cDNA was equivalent to the kakusei cDNA corresponding to the neural activity - inducible transcript (Figure 1A).

The primers and probes for quantitative RT - PCR were designed based on the nucleotide sequences corresponding to the above - mentioned putative neural activity - inducible Acks transcript (Figure 1A).

These findings suggest that the cloned Acks cDNA also contained nucleotide sequences corresponding to the putative neural activity - inducible Acks transcript, and that, like the kakusei - transcript, the Acks transcript functions as a non-coding RNA.

Not exact matches

In some sequences, they systematically changed purine RNA nucleotides, containing the bases adenine or guanine, into the corresponding DNA purines.

This construct was used to introduce the corresponding human FOP mutation R206H and the constitutive active variant of the receptor Q207D by Site - Directed Mutagenesis (QuikChange, Stratagene) using the following primer pairs (with lower - case letters indicating the nucleotides changed relative to wild - type Acvr1 sequence): R206H - chAcvr1 - fwd, 5 ′ - GCAAAGAACAGTGGCTCaCCAGATCACGCTTGTGG - 3 ′ and R206H - chAcvr1 - rev, 5 ′ - CCACAAGCGTGATCTGGtGAGCCACTGTTCTTTGC - 3 ′; chAcvr1 - ca - Q207D - fwd, 5 ′ - GCAAAGAACAGTGGCTCGCgAcATCACGCTTGTGGAGTG - 3 ′ and chAcvr1 - ca - Q207D - rev, 5 ′ - CACTCCACAAGCGTGATgTcGCGAGCCACTGTTCTTTGC - 3 ′).

The downstream sequences were PCR - amplified using a primer with an introduced Spe I site corresponding to the start of the 3» untranslated region at nucleotide 11,704 (UNC - 9C: 5» - TTACTAGTTGACACACCCCAACTTCGTAGC), and a primer at nucleotides 12,836 — 12,860 (UNC - 9D: 5» - CTAGTCTTTGCAGAGCAAGTGAGG - 3»).

Hits with a better match in the GenBank nonredundant nucleotide database (NT), corresponding predominantly to human genomic background sequences resulting from misannotations in GenBank, were excluded from the analysis.

Derivatives of this basic construct included removal of the alternative exon 4 by deleting an Nhe I / Apa I fragment (nucleotides 12,259 — 12,543; Figure 3D); replacement of the genomic region covering exons 2 — 6 with the corresponding cDNA sequence (Sal I to Nco I; nucleotides 14,412 — 11,736; Figure 3E) plus additional upstream sequence to allow for recombination with F56B12 (to the Xho I site at nucleotide 15,574); and introduction of a Met to Leu mutation (M121L, ATG to CTG) by PCR amplification with primers that included the sequence change (nucleotides 11,968 — 11,970; Figure 3F).

In addition, a structural change of a single nucleotide unit can produce a corresponding change in the amino acid sequence of a protein molecule.