Sentences with phrase «nucleotide sequence of»

At the highest level of resolution, the user can inspect the nucleotide sequence of individual genes.

To obtain cDNA fragments of the kakusei homolog in Japanese honeybee, PCR was performed using a set of primers designed based on the nucleotide sequence of the European honeybee kakusei, 5 ′ - GGGGAAGCCAGGAGCCGCGGGTTTACAT - 3 ′ and 5 ′ - AGGCAACAGCACACCATGGGCCTTGGAT - 3 ′, with Ex Taq (Takara, Tokyo, Japan).

The isolation and nucleotide sequence of a cDNA encoding the T cell surface protein T4: a new member of the immunoglobulin gene family.

Nucleotide sequence of first 1000 bases of HIV - 1 strain HXB2 provirus.

And since we know the nucleotide sequence of every known microRNA, all that is required is to prepare an anti-miR with a sequence that is exactly the opposite of the miR's,» he said.

Zhang compared the DNA nucleotide sequence of the human version of ASPM to that of two of our great ape cousins, the chimpanzee and the orangutan, as well to more distantly related animals such as rhesus monkeys, seals, dogs, and hamsters.

We elucidated the nucleotide sequence of a gene, and this was published in 1972.

Fiers investigated the nucleotide sequence of the hemagglutinin gene of this duck virus and found that it was indeed very closely related to the strain that started the 1968 Hong Kong outbreak.

In 1972 he and his team were the first to publish the nucleotide sequence of a complete gene.

There is no such «direct» evolution: animals, bacteria, and algae have a common ancestor from which they have diverged, as can be shown by aligning and comparing amino acid sequences of proteins and nucleotide sequences of homologous ribosomal RNA molecules that are found in both bacteria and vertebrates.

Working with French composer Richard Krüll, the pair turned the complete nucleotide sequences of several microbe genes into compositions based on DNA bases: A (adenosine), C (cytosine), G (guanine), and Thymine (which they have translated to «Re,» or D).

Comparison of the structure and nucleotide sequences of Acks and kakusei cDNAs revealed that the nucleotide sequences corresponding to +1946 b to +5175 b of Acks cDNA was equivalent to the kakusei cDNA corresponding to the neural activity - inducible transcript (Figure 1A).

The nucleotide sequences of Acks cDNA of approximately 7.1 kb in length shared approximately 85 % sequence identity with the European honeybee kakusei cDNA, and had additional unique sequences of approximately 700b at its 3 ′ end.

The nucleotide sequences of the 16S — 23S rDNA spacers for the B. burgdorferi isolates analyzed in figure 1 were deposited in GenBank (accession numbers, AF139507 — AF139517).

Not exact matches

DNA, made up of four nucleotide molecules in a sequence, is a code that can be edited and written — not unlike software.

The specific sequence of nucleotides determines the various kinds of life that appear in evolution.

In the words of chemist - turned - philosopher Michael Polanyi, the sequence of nucleotides is «extraneous to» the physical and chemical properties within the molecule» which is to say, the sequence is not determined by inherent physical - chemical forces.

To string millions and billions of nucleotides into a sequence that makes living beings able to live and reproduced, and then say, «Well TIME (little god), made that possible through many, many small changes over time», is also a lot of faith.

The kit also preserves the single - nucleotide variants (SNVs) and SNV frequencies across different sequencing technologies and allows the amplification of cell - free DNA to levels that permit sequencing.

Every tissue in an organism contains a variety of messenger RNA molecules, single - stranded nucleotide sequences bearing instructions for the making of specific proteins.

The nucleotide in M1 RNA, residue C92, which participates in a crosslink with the substrate was deleted and the resulting mutant M1 RNA was shown to cleave substrates lacking the 3» terminal CCAUCA sequence at sites several nucleotides away from the normal site of cleavage.

The Human Genome Project, which sequenced the 3 billion pairs of nucleotide bases in human DNA, was a piece of cake in comparison: Epigenetic markers and patterns are different in every tissue type in the human body and also change over time.

They use one of several proprietary methods to determine the sequence of nucleotide «letters» (A, C, G and T) that encode genetic information.

In the new study, the researchers sequenced the entire genome of mice that had undergone CRISPR gene editing in the team's previous study and looked for all mutations, including those that only altered a single nucleotide.

A catalytic RNA (ribozyme) derived from an intervening sequence (IVS) RNA of Tetrahymena thermophila will catalyze an RNA polymerization reaction in which pentacytidylic acid (C5) is extended by the successive addition of mononucleotides derived from a guanylyl -(3», 5»)- nucleotide (GpN).

Which genes are activated and which are turned off is in part determined by a second tier of information which is superimposed on the nucleotide sequences that provide the blueprints for protein synthesis.

It is a term of art in patent law that renders the claim «open - ended» so that it covers both the listed nucleotide sequence and, more importantly, the listed sequence in combination with additional sequences.

A genome consists of only four different nucleotide bases, or DNA subunits, arranged in a particular sequence.

Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disorder that has been linked to toxic aggregates of poly - Gly - Ala (poly - GA) peptides generated by aberrant translation of an expanded nucleotide repeat sequence.

The Genographic Project: Testing My Maternal Ancestry Commercial testing companies do not need to test my whole genetic sequence — all 3 billion nucleotides, the «letters» of the genetic code — to tap into my past.

That sort of resolution should be good enough to determine the sequence of all the nucleotide bases in the human genetic code.

We present a draft sequence of the Neandertal genome composed of more than 4 billion nucleotides from three individuals.

This database is produced at National Center for Biotechnology Information (NCBI) as part of the International Nucleotide Sequence Database Collaboration, or INSDC.

We have determined additional full - length sequences from two clusters of imported EBOV infections into Mali, and we show that the nucleotide substitution rate (1.3 × 10 — 3 substitutions per site per year) is consistent with rates observed in Central African outbreaks.

Fully sequenced genomes remain rare, so the bulk of the analysis was done by looking at genetic markers known as single nucleotide polymorphisms or SNPs.

It starts with a long DNA strand — called a scaffold — that has a precise sequence of the four molecular units, or nucleotides, dubbed A, C, G, and T, with which DNA spells out its genetic code.

In germline cells PIWI proteins silence the RNA from jumping genes by cutting them in sequences of ~ 30 nucleotides that will become piRNAs.

In the 7 May 2010 issue of Science, an international team of researchers presents the draft sequence of the Neandertal genome composed of over 3 billion nucleotides from three individuals.

DNA is made of four substances — the nucleotide bases adenine, guanine, thymine, and cytosine — that will combine only in specific configurations and sequences.

Analysis of partial nucleotide sequences has enabled the team to refine our picture of the evolutionary history of cervids.

Bustamante and Poznik obtained highly accurate sequencing results over a length of about 10 megabases of Y chromosome DNA (or 10 million nucleotides) for each of the 69 individuals.

«By analysing the first nucleotides we are able to identify which sequence of gene starts the transcription.

Their trouble with language had been caused by the change of a single nucleotide of DNA — just one letter in the genetic sequence.

The blade, he found, is an enzyme that always cuts the viral DNA code where it finds a particular short sequence of nucleotides.

Even if we assume that a trillion trillion trillion trillion unique sequences 180 nucleotides long could function as RNA replicases, the probability of hitting any one of them in a single shot is still only about 1 in 1060.

The 5386 nucleotides of fC became the first complete DNA to be sequenced (by Fred Sanger's laboratory in Cambridge in 1977) and Sinsheimer is justifiably proud at having put fC on the map.

Bartlett and Davidson devised a technique called Forensically Informative Nucleotide Sequencing, or FINS, mainly for use in verifying that processed fish products are made of the species they claim to be.

Normally, mutations in genetic sequences that give rise to herbicide resistance happen at the scale of a single nucleotide.

A chromosome is, minimally, a very long, continuous piece of DNA, which contains many genes, regulatory elements and other intervening nucleotide sequences.

Once the appropriate sequence of nucleotides is known, the aptamers can be easily generated.