Sentences with phrase «nucleotide sequences at»

Telomeres are stretches of protective, repetitive nucleotide sequences at the ends of chromosomes.

Not exact matches

The nucleotide in M1 RNA, residue C92, which participates in a crosslink with the substrate was deleted and the resulting mutant M1 RNA was shown to cleave substrates lacking the 3» terminal CCAUCA sequence at sites several nucleotides away from the normal site of cleavage.

This database is produced at National Center for Biotechnology Information (NCBI) as part of the International Nucleotide Sequence Database Collaboration, or INSDC.

Fully sequenced genomes remain rare, so the bulk of the analysis was done by looking at genetic markers known as single nucleotide polymorphisms or SNPs.

Next they copied the promising RNA molecules using a technique that caused small mutations in their nucleotide sequences and let these mutated RNA molecules have another go at the reaction.

The 5386 nucleotides of fC became the first complete DNA to be sequenced (by Fred Sanger's laboratory in Cambridge in 1977) and Sinsheimer is justifiably proud at having put fC on the map.

Normally, mutations in genetic sequences that give rise to herbicide resistance happen at the scale of a single nucleotide.

Telomeres are repetitive nucleotide sequences found at the end of chromosomes which protect them from deteriorating during the process of replication.

The study used whole - exome sequencing to characterize genetic alterations that occur at the single nucleotide level for all genes in 25 cell lines commonly used as models of bladder cancer.

Today, researchers at the Centers for Disease Control and Prevention (CDC) in Atlanta announced that they, too, had finished sequencing the virus's genome, and that it differed from the Canadian version in only 15 of its almost 30,000 nucleotides.

Sequences are deposited at the EBI nucleotide database with accession numbers: Neandertal 1 (Feldhofer 1) FM865407, Neandertal 2 (Feldhofer 2) FM865408, Sidron 1253 FM865409, Vindija 33.25 FM865410, Mezmaiskaya 1 FM865411

The nucleotide sequences of Acks cDNA of approximately 7.1 kb in length shared approximately 85 % sequence identity with the European honeybee kakusei cDNA, and had additional unique sequences of approximately 700b at its 3 ′ end.

Next - gen sequencing is particularly useful for analyzing highly fragmented DNA, adds Eske Willerslev, a geneticist at the University of Copenhagen's Natural History Museum of Denmark, because it can capture the sequences of exceedingly short stretches of nucleotides.

Delbrück's summer course on bacteriophages in 1945 at Cold Spring Harbor in New York set in motion the chain of events that led to understanding the genetic code by which the sequence of the nucleotides in DNA is translated into the sequence of amino acids in a protein.

Using cutting - edge techniques enabled by next - generation sequencing, the authors generated complete methylome maps at single nucleotide resolution in a low - passage breast cancer cell line and normal breast tissue (primary human mammary epithelial cells).

PULLMAN — Researchers at Washington State University have identified a new class of DNA sequence variation in gene promoter regions that could help control the activity of genes.The novel variations, dubbed «multiple nucleotide length polymorphisms,» or MNLPs, altered transcription of the genes they were associated with as much as 11-fold.

A single DNA sequence is formed from a chain of four nucleotide bases and if some individuals in a population do not carry the same nucleotide at a specific position in the sequence, the variation is classified as an SNP.

Four types of reversible terminator bases (RT - bases) are added and the sequencing strand of DNA is extended one nucleotide at a time.

«By combining different methods for RNA sequencing with new bioinformatics tools we could find novel sites of nucleotide base exchange, so - called editing», says Jens Lagergren, Professor at the Royal Institute of Technology and group leader at SciLifeLab Stockholm.

At the highest level of resolution, the user can inspect the nucleotide sequence of individual genes.

The downstream sequences were PCR - amplified using a primer with an introduced Spe I site corresponding to the start of the 3» untranslated region at nucleotide 11,704 (UNC - 9C: 5» - TTACTAGTTGACACACCCCAACTTCGTAGC), and a primer at nucleotides 12,836 — 12,860 (UNC - 9D: 5» - CTAGTCTTTGCAGAGCAAGTGAGG - 3»).

A consensus sequence based on mapped deep sequencing reads was generated for each of the prostate cancer XMRV genomes and used to correct errors in the previously published sequences, with the requirement of no ambiguity at each discrepant nucleotide position.

Massive parallel sequencing (MPS) can accurately quantify mitochondrial DNA (mtDNA) single nucleotide variants (SNVs), but no MPS methods are currently validated to simultaneously and accurately establish the breakpoints and frequency of large deletions at low heteroplasmic loads.

Derivatives of this basic construct included removal of the alternative exon 4 by deleting an Nhe I / Apa I fragment (nucleotides 12,259 — 12,543; Figure 3D); replacement of the genomic region covering exons 2 — 6 with the corresponding cDNA sequence (Sal I to Nco I; nucleotides 14,412 — 11,736; Figure 3E) plus additional upstream sequence to allow for recombination with F56B12 (to the Xho I site at nucleotide 15,574); and introduction of a Met to Leu mutation (M121L, ATG to CTG) by PCR amplification with primers that included the sequence change (nucleotides 11,968 — 11,970; Figure 3F).

The nucleotide sequences for all integrases available in the database INTEGRALL [51] were downloaded (1323 sequences) and grouped using single - link hierarchical clustering with a cut - off of 90 % sequence similarity over at least 50 amino acids.

The NCBI Taxonomy database contains the names of all organisms that are represented in the genetic databases with at least one nucleotide or protein sequence.