Sentences with phrase «of allelic variant»
Four dogs with this allele were DNA sequenced, and none contained the SNP of allelic variant 1.
http://journals.plos.org/
Most of the allelic variants represent disease - causing mutations.
Not exact matches
Mutations are cataloged in OMIM in the Allelic Variants section of gene entries (see 1.2).
By looking at your specific allelic variants of your HLA family of genes, genetic testing can help you determine if genetics play a role in your gluten sensitivity.
Allelic variant 3 is an insertion of 24 nucleotides at position -78 of the canine Cox - 2 gene (CGCCTCCGCCTCCGCCTCCGCCGC).
The allelic variant, RS3 334, is associated in men, but not women, with a lower bonding quality with the partner (characterized by lower scores on the partner bonding scale and a greater likelihood of reporting martial problems)(Walum et al., 2008).